qPCR 2007 Symposium POSTER
Presentations
Main Session:
microRNA
– siRNA Applications
Poster
number P 001 – P
009 Location:
Student Cafeteria P 001 Regulation
of cadmium-induced responses in Arabidopsis
thaliana: The role of microRNAs. Smeets K., Cuypers A.,
Donckers K., Remans T., Vangronsveld J. Centre for
environmental sciences, Email:
karen.smeets@uhasselt.be As a highly
toxic metal, knowledge
about cadmium-induced pathways in plants is rather scarce. Cadmium does
appear
to provoke several oxidative stress related effects, similar to other
heavy
metals. Because of its non-redox active nature, the induced redox
disequilibrium has to be established via indirect pathways. A specific
role of
this increased ROS-content in the regulation in cadmium-induced
responses,
however, remains to be elucidated. Therefore,
the early effects of
cadmium toxicity were examined by performing a complete transcriptome
analysis
in Arabidopsis thaliana in combination with the analysis of
specific
cadmium-induced microRNAs. From these results, a highly coordinated
expression
response can be concluded during moderate cadmium toxicity, in which an
increased ROS-content could play a central role. Furthermore, the
induced/inhibited regulative genes are already responding after a few
hours of
exposure and expression is well regulated between the different organs. In this study
environmental
realistic exposure concentrations were used, therefore the outcome is
highly
relevant for further research on heavy metal contamination. P
002 Efficient
and specific quantification of mammalian
microRNAs using a novel real-time PCR approach. Martin Kreutz1,
James Qin1,
Holger Engel 2, Po-Jen Shih1, Martin
Schlumpberger 2, Subrahmanyam Yerramilli1,
and Eric Lader1 1QIAGEN
Sciences, Email:
martin.schlumpberger@qiagen.com We have
developed an efficient and
accurate method for transcriptome-wide miRNA quantification using a
SYBR Green
based, real-time PCR detection system. The miScript System is highly
specific
and sensitive, and requires very small amounts of input RNA. The system
enables
detection of miRNAs as well as mRNAs using the same cDNA preparation
allowing
simultaneous quantification of miRNA and target mRNA. A single cDNA
prep is sufficient for
quantification of several miRNAs of interest, avoiding the need to
prepare
multiple cDNA preps to quantify each miRNA. Use of a single prep
eliminates
potential variation that could arise during multiple cDNA synthesis
reactions.
We will demonstrate the application of this technology to miRNA
expression
profiling in a model human cell-culture system. This
technology offers researchers a
sensitive, specific, and easy-to-perform approach for accurate
expression
profiling of miRNAs using a small amount of total RNA containing
miRNAs. A
single cDNA prep from a precious RNA sample is sufficient for profiling
of all
the known miRNAs in a given model system. This is a substantial advance
in the
state of the art and would be of broad interest to all scientists
studying
miRNAs and their targets P
003 Measure
of miRNAs in microdissected colorectal tumor
tissues: optimization of RNA preparation. Stefania Gelmini, Marta Tarter,
Francesca Salvianti, Claudio Orlando, Lisa Simi, Mario Pazzagli, Pamela
Pinzani. Clinical
Biochemistry Unit, Dept. of
Clinical Physiopathology, Email:
s.gelmini@dfc.unifi.it MicroRNAs
(miRNAs) are short
non-coding RNA molecules involved in gene expression regulation by
repressing
translation or cleaving RNA transcripts. Recently a connection between
miRNAs
and cancer was suggested: several authors reported an altered
expression of
miRNAs in different cancers where they could function as both tumor
suppressor
or oncogenes. miRNA analysis has generally been performed by microarray
techniques in order to identify the specific expression profile
involved in
different types of cancers. On the basis on known complementary
nucleotide
sequences, computer-based prediction model have been developed in order
to
identify the specific target genes of miRNA; several relevant
association with
target genes, either oncogenes or tumor suppressors, have been found
but the
genetic pathways under miRNA regulation have still largely to be
determined The
laser microdissection is the method of choice to collect pure cell
population
starting from complex tissues. This technique has been already largely
used to
identify specific expression profile of mRNA in a single cell or in
different
cell compartment in the same tissue. In order to obtain in a series of
microdissected colorectal tumor tissue samples a sufficient quantity of
RNA for
gene expression analysis and for a specific related miRNA
quantification, we
have utilized several RNA extraction methods either specific for miRNA
(MIRACLE
miRNA Isolation kit, Stratagene) or for total RNA by a specific reagent
(Trizol, Invitrogen) or by a lysis buffer (Side Step Lysis and
Stabilisation
Buffer, Stratagene). We have performed a quantitative relative measure
of total
(18S) and miRNA by Real Time PCR (TaqMan); the miRNA were miR-31 and
miR-135-b.
These two miRNAs resulted altered in colorectal tumors in comparison to
relative normal tissues (Bandres et al, 2006). The relative
quantification is
obtained normalising to a RNU6b miRNA. All miRNA measurements were
performed by
TaqMan MicroRNA assay (Applied Biosystem). For the evaluation of total
RNA
extracted we have used a primers and probe for 18S RNA (Pre-Developed
TaqMan
Assay Reagents, Applied Biosystem). Results obtained by MIRACLE show
high
specificity in the miRNAs extraction and high accuracy for their
detection
starting from about 10 cells/tube. The other techniques (Trizol,Lysis
Buffer
Stratagene) were able to detect both total RNA and miRNAs with
sufficient
sensitivity, reproducibility and accuracy, even if the performances of
Stratagene buffer was affected, in same cases, by sample interferences
due to
the presence of DNA or proteins in the lysate. In all samples (n= 5),
miR-31
and miR-135-b resulted overexpressed in tumor microdissected samples in
comparison in normal paired tissue. P
004 MicroRNA
Expression Signatures as potential Biomarkers
in Thyroid Cancer. Astrid Potratz1,
Cara
Martin2,3, Simone Guenther1,O’Leary
J.23,
Orla Sheils2 (1)Applied
Biosystems, Applera
Deutschland GmbH, Frankfurter Strasse 129b, Email:
GuenthSM@eur.appliedbiosystems.com Cancer is
caused by abnormal
cellular proliferation and the inappropriate survival of damaged cells,
which
may result in tumor formation. Cells have developed several safeguards
to
ensure a correct and coordinated cell division, differentiation and
death. A defect
in the regulatory factors, e.g. tumour-suppressor genes and oncogenes,
will
increase the propability of tumour development. MicroRNAs
(miRNA), short non-coding,
single-stranded RNAs, constitute a novel class of negative gene
regulators.
Specific miRNAs may even control several target mRNAs resulting in
diverse and
complex biological processes. Recent evidence indicates that miRNAs
might also
function as physiological tumour suppressors and oncogenes. Repressing
the
expression of important cancer-related genes, miRNAs might therefore
prove a
valuable tool in the diagnosis and treatment of cancer. Thyroid
cancer cell line: The
expression profiles of 157 miRNAs in thyroid cancer cell lines have
been
analyzed using the Applied Biosystems TaqMan MicroRNA Assays. Specific
miRNA
patterns associated with different pathological pathways have been
identified,
indicating that miRNAs can be used to reliably discriminate between two
common
triggers of thyroid cancer. The predicted mRNA targets of these
differentially
expressed miRNAs belonged to genes involved in regulatory molecular
functions
such as signalling pathways, cell division control and transcription.
This
correlates nicely with the respective gene expression profiles using
the
Applied Biosystems Whole Genome Array System. There, genes involved in
the MAPK
signalling pathway, oncogenesis and transcriptional regulation where
shown to
be upregulated whereas several cell cycle regulators were found to be
down-regulated. Cervical
cancer cell line: The
expression profile of 180 miRNAs in two cervical cancer cell lines was
studied
using TaqMan miRNA Assays. miRNA was extracted using Ambions mirVana
miRNA
isolation system. miRNA extracted from histologically normal cervical
tissue
was used as a reference. A specific
different miRNA
expression signature in the cancer cell lines was observed compared to
normal
cervical tissue. Several of these differentially expressed miRNAs are
predicted
to interact with cell cycle regulatory molecules. These findings
highlight the
potential importance of miRNA molecules also in cervical cancer. The
determination of miRNA profiles
as a new class of biomarkers has the potential to significantly improve
diagnostic accuracy and prognostic information. P
005 Effects
of segmental trisomy on the expression of
microRNA genes by qRT PCR. Blatny R., Ivanek R.
& Forejt J. Institute of
Molecular Genetics AS
CR, Email:
blatny@biomed.cas.cz In our pilot
study, we have used
adult mice of the Ts43H mouse model of human aneuploidy syndromes
carrying
largest known segmental trisomy of an autosome with more than 300 genes
[1]. We
were interested in consequences of the segmental gene dosage imbalance
on
transcription of genes located in the trisomic region (up to 21 genes,
depending
on the tissue type) in comparison with genes located in the disomic
region (up
to 15 genes) of the same chromosome. MicroRNA
genes are known to be
example of non-codingRNA genes with strong regulatory potential and are
therefore candidate genes in study of development of different
pathological
states including aneuploidy syndromes. We have measured expression
levels of
three mature microRNA molecules located in a cluster inside of the
trisomic
region and one mature microRNA located on another chromosome. We have
selected
brain as our target tissue, since cognitive abilities were shown to be
affected
in the model [1], and we used liver as a control tissue. We are
reporting significant
differences in individual protein-coding genes between control animals
and
trisomic animals, mainly for genes in the trisomic region. The average
expression level of protein-coding genes in the trisomic region was
~1.6-fold
in both liver and brain, which corresponds with the altered gene dosage
and
does not indicate any kind of dosage compensation. In the disomic
region, the
average expression level was ~1.0-fold in liver and ~0.9-fold in brain,
which
indicates slight downregulation of the disomic part in brain. However,
statistical significance of this difference remains unclear. These
findings are
generally in agreement with studies on different mammalian models of
aneuploidy
and contrast with non-additive gene expression reported in some plants
and Drosophila
melanogaster . Finally, we
are presenting for the
first time measurements of gene-dosage effects on microRNA genes in a
mammalian
genome. The three microRNA genes located in the trisomic region were
upregulated ~1.5-fold. However, the microRNA gene located on another
chromosome
was found downregulated (0.8-fold). 1. Vacik, T.,
et al., Segmental
trisomy of chromosome 17: A mouse model of human aneuploidy syndromes. PNAS,
2005. 102(12): p. 4500-4505. P
006 MicroRNA
profiling of breast cancer using Locked
Nucleic Acid (LNA) based technologies. Jacobsen N.1,
Nørholm M.1,
Glue C.1, Stahlberg N.1, Eriksen J.2,
Svane I.
M.2, Flyger H.2, Balslev E.2,
Møller S.1,
and Litman T.1. 1Exiqon, Email:
jacobsen@exiqon.com Abnormal
expression of microRNAs
(miRNAs) in cancer implies that these small ~22-nucleotide molecules
play a
role in oncogenesis Therefore miRNAs may comprise a novel class of
diagnostic
and prognostic signatures. Here, we study the global expression
profiles of
miRNAs in breast cancer and normal adjacent tissue in order to identify
possible new biomarkers for breast cancer. Here, we
present miRNA expression
profiles from tumor and normal breast tissue, and found numerous
differentially
expressed miRNAs, including those previously reported to be associated
with
breast cancer, such as let-7a/d/f, miR-125a/b, miR-21, miR-32, and
miR-136. The
differential expression profiles from miRCURYTM LNA Arrays
have been
confirmed using real-time PCR assays. The real-time RT-PCR detection is
a
useful tool in addition to Northern blot analysis. We envision
that the different
platforms compared in the current study will facilitate an efficient
workflow
for identification of e.g. disease related miRNAs and subsequent
development of
reliable diagnostic and prognostic assays. P
007 Comparison
of miRNA expression patterns using the
total RNA extracted from formalin-fixed paraffin-embedded (FFPE) cells
and that
extracted from snap frozen. Li J.1,
Smyth P. 1,
Flavin R.1, Cahill S. 1, Denning K. 1,
Aherne
S. 1 Guenther S. 2, O’Leary J. 1,
Sheils O1 (1)Department
of Histopathology, Email:
GuenthSM@eur.appliedbiosystems.com Introduction: Archival
formalin-fixed paraffin-embedded
(FFPE) tissues represent an abundant source of clinical specimens;
however they
have limited utility in applications involving analysis of gene
expression due
to mRNA degradation and modification during fixation and processing.
Interestingly, miRNAs are a small class of RNA recently described as
playing
important roles in gene regulation, yet their robustness in FFPE is
largely
unknown. This study analyzed 160 miRNAs in paired snap frozen and FFPE
cells to
investigate if miRNAs may be successfully deteced in archival specimens. Methods: N-thy-ori
cells were grown to
confluence and aliquots with equal cell numbers were (a) snap frozen
and (b)
formalin fixed and paraffin embedded into a cell block. Total RNA was
extracted
using protocols: (a)Ambion mirVana miRNA Isolation kit for snap frozen
cells,
(b)Ambion RecoverAll Total Nucleic Acid Isolation Kit for FFPE cells.
The
quality and quantity of RNA yields was measured with Nanodrop and
TaqMan®
microRNA assays, Human Panel-Early Access Kit. Results: To achieve 50
ng of total RNA for
each RT reaction, 10,000 ng of total RNA (for 200 assays), was
extracted from
approximately 2x106 FFPE cells and 1.7x105 snap frozen cells.
TaqMan® analysis
showed a good correlation of miRNA expression pattern between FFPE and
snap
frozen cells, with R2>0.95. The mean of ΔCts (Cts_FFPE normalized to
Cts_snapfrozen) was -1.04107 and the median was -1.152 with
p<0.0001. 65.58%
of ΔΔCts (ΔCts normalized to ΔCts_mean), 101 out of 154 determined
assays, were
between +1 and -1. There was some outlying data in performing the
comparison
between snap frozen and FFPE cells, most notably miR-146 exhibited ~20
fold
decreased expression and miR-302b* ~8 fold increased expression. Conclusion: miRNA
extracted from FFPE blocks was
successfully amplified using Q-RT-PCR. The levels of expression of
miRNA
detected in total RNA extracted from FFPE were higher than that
extracted from
snap frozen cells when the amounts of total RNA were identical. It
seems
reasonable to conclude that this phenomenon was most likely caused by
methylol
cross-links between RNA and protein resulting small RNA molecules being
less
compromised than their larger counterparts. The majority of miRNAs
demonstrated
reliable expression levels in FFPE compared with snap frozen paired
samples
suggesting these molecules might prove to be robust targets amenable to
detection in archival material in the molecular pathology setting. P
008 A
new microfluidic Assay for the Analysis of small
RNAs. Marcus
Gassmann1 , Hans-Joachim Mollenkopf2,
Marc Valer3,
Martin Greiner1 1Agilent Technologies,
Waldbronn, Germany, 2Max-Planck
Institute for Infection Biology, Berlin, Germany and 3Agilent
Technologies Inc., Santa Clara, CA, USA Email:
marcus_gassmann@agilent.com MicroRNAs
(miRNAs) are short
20-22-nucleotide RNA molecules that have been identified recently as
sequence-specific regulators of many cellular processes such as
apoptosis,
proliferation and differentiation. Meanwhile hundreds of microRNAs have
been
discovered in the genomes of animals and plants, but they are only
beginning to
be classified by their functional roles. One of the major drawbacks is
the lack
of adequate analytical methods for the analysis of small RNA samples. Here we
describe a Lab-on-a-Chip
based assay that is able to perform very sensitive high resolution
analyses of
small RNA samples on the Agilent 2100 Bioanalyzer instrument. The assay
delivers information about integrity, size and concentration of small
RNA
species. Purified or enriched small RNA fractions, as well as total RNA
samples
in concentrations can be run in concentrations down to 100 pg/µl. The Agilent
2100 Bioanalyzer is a
microfluidic instrument platform designed for fast separation and
quantification of DNA, RNA, and proteins as well as flow cytometric
analysis on
cells. P
009 Multiplex
microRNA TaqMan® Low Density Array: A
High-Throughput Screening Tool for miRNA Profiling. Yulei Wang, Raymond
Samaha Applied Email:
wangyy@appliedbiosystems.com Main
Session: Single
Cell qPCR
Poster
number P 010 – P
011 Location:
Student Cafeteria P
010 Profiling
of the TrpC expression pattern in cerebellar
Purkinje cells by quantitative single-cell RT-PCR. Dragicevic E.1,Blum R.2,
Hartmann J.1, and Konnerth A.1 1Friedrich-Schiedel
Email:
elena.dragicevic@lrz.tu-muenchen.de The TRPC
(Transient Receptor
Potential Canonical) cation channel family consists of seven members;
TRPC1-7
(Clapham et al. 2001). TRPC subunits are expressed in many brain areas
but
little is known about their cellular function in neurons. It has been
reported
that the TRPC1 cation channel is involved in the mGluR1-dependent slow
excitatory postsynaptic current (ImGluR) in Purkinje cells (Kim et al.,
2003).
However, we found that ImGluR can be evoked in TRPC1 knock-out mice.
This
suggests a role for other TRPC family members in the activation of
ImGluR. To understand
the molecular basis of
TRPC-mediated postsynaptic currents, we investigated the cell
type-specific
gene expression patterns and levels of TRPC encoding transcripts in
single
Purkinje cells of the cerebellum using a quantitative Reverse
Transcriptase-PCR
(RT-PCR) approach (Durand et al. 2006). In our experiments, single
Purkinje
cell somata were obtained by whole soma suction from acute cerebellar
slices,
using microcapillaries. RT-reactions, followed by purification of
single cell
cDNA material were amplified in a real time PCR device (Lightcycler).
Quantification was performed by using high-resolution standard curves,
with
comparable efficiencies, for each subunit. In parallel, single cell
RT-reactions were validated by quantification of the house-keeping gene
glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) in a second qPCR
reaction
using 1/10 amount of the single-cell cDNA. In addition, we use specific
TRPC
knock-out mutants to correlate the expression levels of TRPC subunits
with the
corresponding physiological phenotypes in Purkinje cells. Our findings
revealed that the
subunit TRPC3 (372 copies/cell) and not TRPC1 (44 copies/cell) is the
predominant TRP-family member in Purkinje cells of wild type mice.
TRPC4 (10
copies/cell), TRPC6 (4 copies/cell), and TRPC7 (5 copies/cell) have
been
detected in few copies, while TRPC5 was not detected yet. TRPC1
knock-out mice
show the same TRPC subunit expression pattern. The electrophysiological
analysis as well as the quantitative single cell RT-PCR experiments are
leading
to the conclusion that TRPC3 and not TRPC1 is the most likely molecular
candidate for ImGluR in cerebellar Purkinje cells of the mouse. Clapham, D.
E., Runnels, L. W.,
Strubing, C. (2001) The TRP ion channel family. Nat Rev Neurosci 387-96. Kim, S. J.,
Kim, Y. S., Yuan, J. P.,
Petralia, R. S., Worley, P. F., Linden, D. J. (2003) Activation of the
TRPC1
cation channel by metabotropic glutamate receptor mGluR1. Nature
426:285-291. Durand,
Marandi, Herberger, Blum
& Konnerth (2006) Pflügers Arch. Eur J. of Physiol. 451,
716-726. P
011 Changes
in the gene expression of mRNA transcripts for
insulin like growth factor (IGF-I), their receptor (IGF-IR) and
facilitative
glucose transporter (Glut-I) in IVM oocytes and preimplantation embryos
of S.C. Gupta, Neelam
Gupta,
Alok Pandey National
Bureau of Animal Genetic
Resources, Email:
guptasc@yahoo.com For low rate
of SCNT derived cloned
embryos reaching to normal and viable clones, one hypothesis is that
transcription of one or several developmentally important genes is
affected by
the in vitro environment possibly leading to the disturbance of process
of
differentiation and organogenesis. Therefore embryos exhibiting
abnormal
expression of embryonic genes may be an early indication of incomplete
reprogramming that could result in lower survival rates. The real-time
quantitative polymerase chain reaction (rtqPCR) has overcome the
limitations of
conventional, time consuming quantitative PCR strategies and has been
matured
into a routine tool to quantify gene expression levels, following
reverse
transcription (RT) of mRNA into complementary DNA (cDNA). It is a
sensitive and
very efficient technique to examine gene transcription patterns in
preimplantation embryos. One of the areas of interest in this regard,
is the
analysis of gene expression patterns in nuclear transfer (NT) embryos
to
dissect the processes that failed and develop means to overcome the
limitations
imposed by these factors. The main objective of this study was to
develop an
easy and rapid method for measuring gene expression in a single cell by
real-time PCR without RNA extraction and purification by using cell to
cDNA II
kit (Ambion). Based on the developed RT-PCR methodology, we constructed
cDNA
libraries with single matured oocytes at 0h, 6h, 12h, 18h and 24h of
maturation
and of embryos at different stages of development (2-cell, 4-cell,
8-cell,
16-cell, morula and blastocyst). Real time PCR cycler was performed
using
Brilliant SYBR Green Q-PCR master mix (Stratagene) to determine more
precisely
the transcription levels of IGF-I, IGF-II, and Glut-I in SCNT produced
buffalo
embryos derived from skin fibroblast cells at preimplantation
development. The
primers of selected genes GAPDH (reference) and IGF-I, IGF-II, and
Glut-I
(target genes) for expression studies were designed using the Gene Bank
sequences within only one exon in the range of 80-200 bp products.
Standard
curve for reference and all the target genes were developed for the
relative
quantification of gene expression. IGF-I transcript expression was
clearly
visible only in matured oocytes. It was elevated up through 12h of the
culture
and then declined gradually at the end of 24hrs maturation. IGF-IR, was
expressed throughout preimplantation development upto the blastocyst
stage,
while the expression of facilitative glucose transporter (Glut-I) was
also
expressed in all stages studied. Gene expression analysis of those
genes which
plays a important role in activation and reprogramming of matured
oocytes and
cloned embryos would enable us to better understand the early
biological events
during preimplantation after nuclear transfer. Session:
Immuno - qPCR
Poster
number P 012 – P
013 Location:
Student Cafeteria P
012 Real-time
immuno-PCR: a new perspective for prion
blood screening tests. Ruelle V., ElMoualij
B.,
Heinen E. and Zorzi W. Center of
research on Prion Proteins, Email:
v.ruelle@ulg.ac.be Prion
diseases such as
Creutzfeldt-Jakob of human, scrapie of sheep and bovine spongiform
encephalopathy of cattle are fatal neurodegenerative disorders
characterized by
behavioural and locomotor changes, cerebral amyloid plaques and
spongiform
degeneration of the brain1. In 1996, the first case of
variant of
Creutzfeldt-Jakob disease (vCJD) was diagnosed in the The classical
techniques used to
diagnosed prion protein (Western blot assays and enzyme-linked
immunosorbent
assays)5 are not sufficiently sensitive to detect the low
levels of
prion in the blood. Consequently, it is necessary to develop a
sensitive
technique allowing the diagnosis of prion protein in blood. In this
study, we therefore focussed
on the detection of the prion protein in blood by
immuno-quantitative-PCR
(iqPCR)6. This technique combines the sensitivity of PCR, by
an
exponential amplification of reporter DNA, and the specificity of the
detection
of antigens, by antibodies in an ELISA format7-8. To
illustrate the
advantages of iqPCR, we have compared it with a conventional ELISA
technique in
experiments aimed at detecting the resistant form of prion protein in
human
plasma. Using iqPCR, a minute quantity of prion was detected in blood
spiked
with infected CJD sample with a detection threshold at least 400-fold
lower
than classical ELISA. The iqPCR
technique being
ultra-sensitive, it could be a technique of choice for the development
a new
blood screening tests allowing the prion protein diagnosis in infected
human
and animals ; both at ante-mortem and post-mortem stage. P
013 Andreas
Fischer1, Thorsten Kuczius2,
Christof von Eiff1,
Georg Peters1, Karsten Becker1 Email:
a.fischer@uni-muenster.de TSS-mediating
staphylococcal toxins:
A novel quantitative real-time immuno-PCR approach for ultra-sensitive
detection of SEB and TSST-1 Staphylococcus
aureus is a major
human pathogen characterized by a strain-dependent spectrum of
virulence
factors. One of these is the family of the bacterial pyrogenic toxin
superantigens (PTSAg), comprising the toxic shock syndrome (TSS)
mediating
toxins TSST 1 and staphylococcal enterotoxin B (SEB). As morbidity and
mortality from TSS are substantial, early and reliable recognition of
TSS is critical.
In addition to their nature as superantigens, enterotoxins also
function as
potent gastrointestinal toxins with a major public health impact. Immunological
methods used until now
are known to be limited in sensitivity and specificity, revealing an
obvious
need for new highly sensitive and specific methods for the detection of
staphylococcal toxins. For this reason, two quantitative real time
immuno-PCR
(qRT-iPCR) approaches for the detection of SEB and TSST-1 have been
developed. The detection
of TSST-1 and SEB,
respectively, was achieved by coating toxin-specific polyclonal sheep
antibodies (ABs) to microtiter plates in order to capture the target
superantigens followed by specific detection of the antigen-AB complex.
The
resulting immunocomplex was subsequently detected using a covalent
antibody-DNA
complex, which was synthesized using amino-modified and
maleimide-activated
reporter DNA and N-succinimidyl-S-actyl-thioacetate-modified secondary
detection antibodies. Quantitative real-time amplification of the
reporter-DNA
was performed for final detection of the toxins. By usage of this qRT-iPCR technique, superantigen toxin was highly reproducible detected at approximately 10 to 100 pg/ml (0,4 to 4 amol/µl), thereby lowering the limit of detection (LOD) of these toxins by a factor of up to 100 compared to commercially available EIAs. Furthermore, qRT-iPCR offers a high versatility, giving the opportunity of adapting the protocol to detect a broad range of antigens, provided that antibodies for the desired antigens are available. Covalent attachment of different reporter-DNAs to specific antibodies could be used to extend the qRT-iPCR to a multiplex detection platform. Session:
Pre-analytical-Steps
Poster
number P 014 – P
022 Location:
Student Cafeteria P
014 Evaluation
of different RNA extraction methods for
small quantities tissue from the marine flatworm Macrostomum lignano. Plusquin M., Smeets K.,
Geerdens E., Remans T.,
Cuypers A., Artois T. Email:
michelle.plusquin@uhasselt.be Highly
sensitive techniques for
transciptome analysis, such as real-time PCR, microarrays and others
currently
used in functional genomics require a high integrity and quality of the
RNA, as
well as reproducibility between replicates of the same tissue. Our
test-organism Macrostomum lignano is a small marine flatworm
that has an
average weight of 350 µg. Because culture of Macrostomum
lignano is
labour intensive our goal was to isolate RNA from small quantities of
sample
material. Samples were lysed with different mechanical lyses such as
pulverisation, mixing with steal beads and sonication. Total RNA was
then
extracted using TRI- Reagent ®, as well as commercial kits based on
RNA binding
to silicon membranes (Qiagen, Roche) or magnetic beads (Invitrogen).
RNA
concentrations and purity was assessed using a nanodrop ® -ND 1000
UV-Vis
Spectrophotometer using a 1 µl aliquot of the total RNA
solutions. RNA
integrity of the extracted RNA molecules was evaluated in 1 µl
using an Agilent
2100 Bioanalyzer with the RNA 6000 Pico labChip® kit. P
015 Automated
RNA extraction using new Agencourt SPRI
technology. Souquet M. Email:
msouquet@beckman.com Agencourt
RNAdvance is an Agencourt
SPRI® paramagnetic bead-based purification system for the isolation
and
purification of total RNA from cultured eukaryotic cells, tissue or
blood.
Agencourt RNAdvance is a consistent and automation-friendly method for
utilization in downstream microarray and real-time gene expression
analysis.
This technique reliably delivers high recovery and purity without the
need for
filtration or centrifugation and is especially well suited for
automation using
Beckman Coulter Biomek® solutions. P
016 Advanced
Data Mining Software for Applied Biosystems
RT-PCR Data Analysis. de Alarcon P.1 Ferlinz A.2 1Integromics
SL, Email:
pedro.dealarcon@integromics.com Great
advances in instrumentation,
accurate fluorescence detection, improvements in reagents (eg. by means
of ABI
Taqman probes) and protocols have increased the use as well as the
range of
applications of quantitative RT-PCR experiments. Nowadays, RT-PCR is
the best
technique for relative gene expression quantification and it is
expanding to
other areas like miRNA profiling, biomarker discovery, diagnostics and
Copy
Number Analysis. Moreover, the amount of data generated is also growing
as
experiments are being performed within a high-throughput context. In
this
sense, advanced bioinformatic tools that help researchers in the
analysis and
interpration of raw data are demanded by the scientific community as a
key
complement to the instrumentation and reagents. In the present poster,
Integromics introduces a new high-performance software specifically
designed
for the new era of quantitative RT-PCR. The software has been built
around four
principles, namely: high-throughput statistics and data mining,
interactive
visualization, functional interpretation and extensible modular
approach.
State-of-the-art statistics are key to provide quality control and
analysis of
raw data for filtering of outliers and noisy experiments. Further
procedures
are provided towards the assesment of expression stability of
endogenous genes
(like Normfinder), differential expression by means of statistical
tests, and
clustering techniques for grouping similar expression profiles. All the
statistics are implemented in the R language which ensures the
capability of
dealing with large amounts of data as well as benefiting from the
existing
libraries in Bioconductor (www.bioconductor.org). The software is
implemented
as a plugin of Spotfire Decisionsite, a leading application for
professional
and interactive visualization of multidimensional data. Visualizations
in
Spotfire facilitate the task of exploring large datasets (possibly with
hundreds of genes and samples) so that it becomes easier to pose
interactive
queries and focus on relevant results. Even more, once the results from
the
analysis highlight the existence of characteristic expression profiles,
it is
crucial to enrich the numerical information with functional annotations
provided by content repositories like the Panther database
(www.pantherdb.org).
As mentioned above, RT-PCR is a powerful technique that can be applied
in many
different contexts like relative quantification, miRNA profiling or
genotyping.
However, it is unrealistic to provide software that cannot be adapted
to such
diversity. In this sense, the software implements analytical workflows
that can
be easily adapted to specific user needs or experimental settings. A
workflow
is a set of sequential steps that guides the user from the importing of
raw
data to the final analysis in a very natural manner. This facilitates
the use
of the tool by non-experts in biostatistics but does not limit its
power as
statiticians can add or manipulate the procedures contained in the
software. P
017 Preamplification
of Sample Limited Specimens for
Real-Time Gene Expression Analysis. Junko Stevens 1,
Renata Coudry2, Cynthia Spittle3 1Applied Email:
stevenjn@appliedbiosystems.com Accurate gene
expression profiling
can be compromised by the quantity of RNA that is isolated from cells
or
tissues. We have developed a robust solution for uniform amplification
of cDNA
prior to quantitative, real-time PCR. TaqMan® Preamp Master Mix
allows
preamplification of up to 100 gene targets simultaneously using the
TaqMan®
Gene Expression Assays as the source of pooled gene-specific primers.
TaqMan
assay-based preamplification preserves equilibrium of targets and
retains the
relative copy numbers of starting targets in a reproducible and precise
manner.
Preamplification of random-primed cDNA is independent of amplicon
distance from
the 3’ end, making it amenable to use with partially degraded or viral
RNA.
Uniformity of preamplification was demonstrated using Laser Capture
Micro
dissection (LCM) in formalin-fixed, paraffin embedded (FFPE) tissue.
RNA
extracted from clinical samples was reverse transcribed to cDNA using
High
Capacity cDNA Reverse Transcription Kit The simple workflow enables
researchers
to enrich the amount of limited RNA samples uniformly within 1.5 hours. P
018 qPCR
with mRNA isolated from urothelial cells from
urine. Bontrup H., Delbanco
J.,
Bruening T., Johnen G. BGFA, Email:
bontrup@bgfa.ruhr-uni-bochum.de Objectives Bladder
cancer in chemical workers
is an occupational disease associated with previous exposure to
aromatic
amines. Currently, urine-based markers used for screening of high-risk
collectives are not of high sensitivity. To detect cancer at earlier
stages
more suitable non-invasive markers are necessary. Some promising new
tumor
markers are based on mRNA quantitation. The aim of this study was to
establish
and optimize a practical and efficient mRNA isolation method that
allows
applying qPCR-based assays with urothelial cells from urine. Methods Six different
isolation methods on the basis of commercially available kits were
compared
using urine samples of healthy donors and a control RNA with known
concentration. A situation was simulated comparable to sample
collection in a
clinical setting. Cells were collected from urine by centrifugation and
transferred to a buffer according to the manufactures recommendations.
After
short (48 h) storage at -20°C the mRNA isolation was performed. In
all tested
assays mechanical disruption of the cells was identical. The six
isolation
methods differed by DNA removal step (DNase treatment or special DNA
column)
and material of the RNA columns. After isolation, extracted RNA was
transcribed
to cDNA and quantified on a LightCycler system using an adapted
Taqman-based
assay for ß-Actin (FDI, Results It was
possible
to establish a system for mRNA isolation from urine but the analysis
showed
that urine as a starting material yields high contaminations with
genomic DNA.
Therefore, DNA removal is essential to obtain mRNA of sufficient
quality for
qPCR. Our results show that DNA could not be removed adequately by
DNase
digestion. Better yield and purity was only possible with application
of a
special glass fibre column that selectively binds DNA. This also allows
to
recover the DNA and use it for other applications. Conclusions Most of the
six
tested methods for mRNA isolation from urine are generally suitable for
downstream qPCR applications. However, best results can be obtained
with a DNA
column-based method (INVITEK, This study
was in part supported by
Fujirebio Diagnostics Inc. P
019 Quantitative
mRNA expression of the embryonic stem
cell marker POU2 in early developmental stages of Kaja Helvik
Skjærven, Elisabeth
Holen National Email:
ksk@nifes.no Embryonic
stem cells (ESC) from
Atlantic cod (Gadhus morhua) have been isolated and cultured
successfully.
The cultured cells showed characteristic features for ESCs, including
spontaneous differentiation and the ability to form embryoid bodies
following
retinoic acid treatment. In addition the ESCs could be directed to
differentiate into neuronal like cells upon stimulation. Detection of
genes that identify
ESCs from other differentiated cells is vital for the method. POU2 is
one such
gene, known to regulate potency, and self renewal in ESCs. Class V
POU5f1 genes
are found in blastula cells of different species; Oct4 in mammals and
POU2 in
zebrafish. We have previously described a fragment of POU2 isolated
from
Atlantic cod that is 100% identical to zebrafish POU2 at the amino acid
level,
but not at the nucleotide level. Using real-time PCR technique, we
report that
blastula cells taken from 1 and 1.5 days post fertilization (DPF)
express the
highest transcriptional levels of POU2. At the early gastrula stage (2
DPF) a
1.5 fold reduction in POU2 expression was correlated to the presence of
some
early differentiating cells. By the late gastrula stage (3 DPF), POU2
expression was barely detectable, and coincided with the presence of
many
differentiated cells. We conclude that POU2 can be used as an ESC
marker for
Atlantic cod, and the method represents an important new research tool
for use
in marine teleost species. P
020 Relative
mRNA quantification models and the impact of
RNA integrity. Simone Fleige and Michael
W.Pfaffl Physiology
Weihenstephan, Email:
fleige@wzw.tum.de Quantitative
real-time PCR has
become one of the most widely used methods of gene quantitation. The
method
exhibits a large dynamic range, boasts tremendous sensitivity, has
little to no
post-amplification processing, and is amenable to increasing sample
throughput.
An essential requirement for a successful quantitative mRNA analytics
using
qRT-PCR is the usage of intact RNA. Low-quality RNA may compromise the
derived
expression results. The importance of RNA quality for the qRT-PCR was
analyzed
by determining the RNA quality of different bovine tissues and cell
lines
(n=11). Diverse artificial and standardized RNA degradation levels were
assessed using the capillary electrophoresis system (Agilent
Bioanalyzer 2100).
The RNA quality was classified according the RNA integrity number
(RIN).
Further on, a research into the effect of different length of amplified
products and RNA integrity on expression analyses was investigated.
Degraded
RNA interferes with qRT-PCR performance as such, expressed as Ct value,
whereas
PCR efficiency is minor effected by RNA integrity. Statements about
importance
of normalization could be confirmed by our investigations, consequently
we
commended an efficiency-corrected relative quantification strategy and
normalization with at least one internal reference gene. We can
recommend a RIN
higher than five and a PCR product length up to 200 bp as a minimal
requirement
for a successful and reliable quantitative real-time RT-PCR
quantification. P
021 REPEATABILITY
OF HOUSE DUST SAMPLES IN RELATION TO
QUANTITATIVE PCR OF MICROBES. Pasi Kaarakainen1, Asko
Vepsäläinen1,
Aino Nevalainen1, Teija Meklin1,2 1National
Public Health Institute,
Department of Environmental Health, Kuopio, Finland and 2Technology
Centre Teknia Ltd, Kuopio, Finland Email:
pasi.kaarakainen@ktl.fi Possible
specific associations
between fungal species in our indoor environment and adverse health
effects,
such as respiratory symptoms, asthma and allergy are a major topic of
interest.
House dust sampling has been used to assess microbial exposures and to
describe
microbial populations in indoor environments. However, the
repeatability or
representativeness of such sampling has not been thoroughly validated. In this
study, the repeatability of
house dust sampling was tested. Furthermore, the seasonal variation of
the
microbial populations was analyzed to assess the representativeness of
a single
sampling. QPCR was used for the identification of 16 species or assay
groups of
fungi from house dust samples from five houses without any moisture
damage. The
repeatability of the analysis of a floor dust sample with qPCR was
tested by
isolating DNA from homogenized dust samples as five parallel samples.
Collecting samples in four different seasons enabled the consideration
of
seasonal variation. The highest
concentrations from
analysed species or assay groups of fungi were observed for Aureobasidium
pullulans, Penicillium/Aspergillus/Paecilomyces variotii group, Aspergillus
penicillioides, Cladosporium herbarum and Cladosporium
cladosporioides, respectively.
Fungal concentrations varied between seasons depending on analysed
species or
assay groups. Concentrations of A. pullulans and two Cladosporium
species
were at their highest in summer and autumn while for Penicillium and
Aspergillus species, the differences between different
seasons were not
so obvious. The
repeatability of the parallel isolations of DNA was good for most of
the
analysed species. The best repeatability was observed for assays of C.
herbarum and P. chrysogenum with ICC value (similarity of
the
parallel samples) 84.5 and 83.1 %, respectively. ICC was over 70 % also
for six
and over 60 % for three other assays. In summary, our results suggested
that qPCR
is a promising tool for the microbial analyses from house dust samples
in
epidemiological studies. In determining the qualitative procedures of
the
method and the reliability of the results, homogenization of the sample
matrix
and the number of the repeats of analyses are the primary issues. P
022 RNA
Integrity database: A web repository enabling RNA
trace comparisons. Hans Brunnert1,
Martin
Greiner1, Marcus Gasmann1, Michael Kim2,
Marc Valer2 1Agilent
Technologies, Email:
martin_greiner@agilent.com Lab-on-a-Chip
devices are broadly
used for RNA integrity analysis on Micro array and qPCR gene expression
analysis. This creates the need and opportunity for users to screen and
validate
RNA traces for relevance and troubleshooting. Here we describe the
design of
the backbone as well as examples of use for a new RNA profile web
database. The
database aims to host a large variety of sample types spanning
different genus,
tissues and sample treatments, although the database is initially
limited to
contain bioanalyzer traces. Each electropherogram is annotated with
sample
source details as well as analytical data like UV, Ribosomal ratios,
RIN and
more. They also include details on the RNA extraction and the
downstream
experiment. By design the database is open to the scientific community: free querying and curated contributions for individuals as well as large batch uploads from core labs. Individuals are able to compare their own results with those of others with similar samples and protocols. It also allows comparison of alternative RNA isolation methods based on its resulting electrophoretic traces. Session:
qPCR
BioStatistics & BioInformatics
Poster
number P 023 – P
028 Location:
Student Cafeteria P
023 GenEx
for Real-time PCR Gene Expression Profiling. Forootan A., Kubista M.,
Sjögreen B and Andrade J
M TATAA
Biocenter, Sweden MultiD
Analyses, Sweden Dept of Analytical Chemistry, University of A Coruna
Center
for Applied Scientific Computing, Lawrence Livermore National Laboratory Email:
amin.forootan@multid.se The
extraordinary sensitivity and
virtually unlimited dynamic range of real-time PCR makes it the
preferred
technology for gene expression profiling. Candidate marker genes are
identified
by microarray technology and validated on representative samples by
real-time
PCR. False leads are discarded, resulting in very powerful panels of
expression
marker. Such panels can be developed for staging of disease,
classification of
cells, studies of expression pathways, effects of drugs and the like.
The
recent development of high throughput real-time PCR platforms such as
the 384
well plate instruments from Applied Biosystems and Roche, and most
recently the
48x48 (2304 wells) microfluidic card from Fluidigm will spur the
development
further. To extract maximum information from expression profiling
experiments
powerful statistical and mathematical methods are needed to find
correlations
between the measured profiles and identify the genes and samples that
show
common behavior. Here we present GenEx, which is the first windows
based
package dedicated for real-time PCR expression profiling. GenEx has
user-friendly interface that makes advanced analyses really easy. Data
from
multiplate experiments are readily pre-processed and analyzed by
methods such
as geNorm , Normfinder, Principal Component Analysis, Hierarchical
clustering,
Self-Organizing Maps, Potential curves and much more. The results are
presented
in highly attractive plots. www.multid.se The Real-Time
Polymerase Chain
Reaction, M. Kubista, J.M. Andrade, M. Bengtsson, A. Forootan, J.
Jonak, K.
Lind, R. Sindelka, R. Sjöback, B. Sjögreen, L. Strömbom,
A. Ståhlberg, N.
Zoric, Molecular Aspects of Medicine (2006) 27, 95-125 P
024 EM
algorithm for gene copy number estimation using
TaqMan® assays. Catalin
Barbacioru, Kelly Li,
Raymond Samaha and Katherine Lazaruk Applied
Biosystems, Email:
catalin@appliedbiosystems.com Genetic
variation in the human
genome takes many forms, ranging from large, microscopically visible
chromosome
anomalies to single-nucleotide changes. Deletions, insertions,
duplications and
complex multi-site variants, collectively termed copy number variations
(CNVs)
or copy number polymorphisms (CNPs), are found in all humans and other
mammals.
CNVs influence gene expression, phenotypic variation and adaptation by
disrupting genes and altering gene dosage, causing diseases, as in
microdeletion or microduplication disorders, or confer risk to complex
disease
traits such as HIV-1 infection and glomerulonephritis. Recently,
TaqMan® gene
copy number assays have been developed for detection of genetic
variation at
gene level using primers and probes designed for genomic DNA sequences.
Each
well is duplexed with two assays. The FAM™ dye-based assay
is
designed to detect the genes-of-interest and the VIC®
dye-based
assay for detection of the reference gene, RNase P. The difference
between FAM
and VIC measurements (dCT) is indicative of the relative abundance of
the
gene-of-interest against 2 copies per diploid genome regardless of the
status
of the gene-of-interest. In this study, we present an algorithm for
gene copy
number estimation from TaqMan® gene copy number assays
based on EM
algorithm for mixtures of normal distributions. After removing
technical
outliers from data, the algorithm finds maximum likelihood estimates of
parameters in probabilistic models, where the model depends on
unobserved
samples copy number of the gene-of-interest. Estimates of the gene copy
number
and confidence levels in predicted copy numbers are reported for each
sample.
Under current protocols, we are capable of distinguishing up to 8
copies of the
gene of interest with at least 95% confidence, assuming 100% efficiency
of the
FAM™ dye-based assay. To evaluate
this algorithm, we
present experimental results for 5 important drug metabolism genes
(CYP2D6,
CYP2E1, CYP2A6, GSTM1 and GSTT1) on 270 individual samples from
International
HAPMAP Project representing 4 different populations (Caucasian,
African,
Chinese and Japanese). Copy number analysis for these genes shows
perfect
consistency for sample duplicates. Copy number variation (from 0 to 4)
is
observed for all 5 genes. Significant differences of copy number
frequency in
these populations are revealed for CYP2A6, CYP2D6, GSTM1 and GSTT1.
Therefore,
data presented here is most relevant for highlighting variable regions
of the
genome that warrant consideration in disease studies. Furthermore,
combining
this data with SNP data for the same genes, we demonstrate that
departures from
diploidy can cause apparent genotyping failure and give inaccurate
genotyping.
Therefore, measuring copy number variation in these genes is an
important
complement to genotyping assays. P
025 Ross Saad1,
David Chiew1,
Matthew Herrmann1, Valin Reja1, Michael W.
Pfaffl2 1Corbett
Research, Mortlake, NSW, Email:
michael.pfaffl@wzw.tum.de REST 2007 is
new standalone software
for analyzing gene expression using real-time amplification data. The
software
addresses issues surrounding the measurement of uncertainty in
expression
ratios by introducing randomization and bootstrapping techniques. New
confidence intervals for expression levels also allow measurement of
not only
the statistical significance of deviations but also their likely
magnitude,
even in the presence of outliers. Whisker box-plots provide a visual
representation of variation for each gene, highlighting potential
issues such
as distribution skew. REST 2007 builds on its predecessor REST 2005
with
significant improvements to randomization algorithms. This new revision
introduces alternative data inputs such as single sample efficiency and
amplification take-off point, alleviating the need to set amplification
plot
thresholds. http://REST.gene-quantification.info/ P
026 Using
fuzzy logic algorithm and gene expression
database ONCOMINE in COPD outcome forecasting. Shilov B.V., Bukreeva
E.B. Email:
shilov@ssmu.ru Chronic
obstructive pulmonary
disease (COPD) occupies one of the first places in frame of a sickness
rate in
the world. COPD is a focus of chronic inflammation in organism. Chronic
inflammation and its local repeated stress have long been known to be
risk
factors for cancer. Moreover risk of carcinogenesis increases under
influence
infectious pathogen. Examples include: Helicobacter pylor bacterial
infection
and gastric adenocarcinoma; hepatitis B virus and hepato-cellular
carcinoma;
chronic bowel disease and colon carcinoma; EBV and nasopharyngeal
carcinoma in
humans. Thus risk of malignant outcome of disease can be enlarged if a
patient
with COPD has colonization of the infectious agents in his organism. Infectious
agent of inflammation
influences on squamous cell methaplasia development in COPD patients.
This fact
accompanies by increase of squamous cell quantity and rising in
brush-biopsies
reserved cell number belong in G2 phase of cell cycle. Our
investigation
included survey of 37 patients with COPD infectious exacerbation. In
conditions
of similar morphological and pathological changes different patients
had
various genes expression level. There is
known differences in these
genes expression beside healthy humans and malignant disease patients.
Dates
about these differences were obtained from ONCOMINE database with free
access.
ONCOMINE, a cancer microarray database and web-based data-mining
platform aimed
at facilitating discovery from genome-wide expression analyses for
elucidation
state of indicated genes expression in patients with squamous cell
methaplasia.
Search and analysis ONCOMINE results we used in fuzzy logic algorithm
for
expert fuzzy rules forming. When dealing
with gene expression
data, the problem is even more complicated, because no expert exists to
determine what defines a “normal” expression level. Using fuzzy logic,
the full
range of expression data is first measured and is then broken into
discrete
subsections based on the observed data. These discrete subsections then
provide
a qualitative description of the data. Use the
algorithm has allowed
patients classifying on the gene expression basis in groups with
different
forecast of the upshot of the disease. Three groups were chosen:
favorable
forecast (5 patients), stabile condition of the chronic inflammation
(24
patients) and group with high probability squamous cell methaplasia
development
(8 patients). P
027 qRT-PCR
applied to the comparative analysis of plant
splice variants in time-course water-stress experiments. Cantale C., Latini A.,
Sperandei M. and Galeffi
P. BAS BIOTEC GEN,
ENEA, Italy Email:
cantale@casaccia.enea.it The
understanding of the plant gene
response to the environmental stresses at the transcriptional level is
a main
challenge for dissecting their role in the stress tolerance. We
analysed the
expression profile of a DREB-homologous gene, TdDRF1, using Real Time
RT-PCR in
various different Triticum durum and Triticale cultivars
upon
dehydration, both in greenhouse and in controlled field experiments.
The TdDRF1 gene is alternatively spliced and results in three
splice
variants, two of
them codifying for putative transcriptional activators and the third
one
producing an abortive putative protein with an unknown function. For
each of
the examined cultivars, a time-course experiment under water-stress is
carried
out including two groups, the control plants, that continue to be
watered and
the stressed plants, that are no more watered. The experiments are
carried out
using plants at the same growth level and some leaves are collected and
pooled
at fixed times to average the possible individual and position/soil
variability. The three
splice variants, TdDRF1.1, TdDRF1.2 and TdDRF1.3 ,
are 1455bp, 1367bp and
1314bp
respectively and a high sequence identity among the exons in the
regions
flanking the splicing recognition site prevents the design of primers
able to
select exclusively each transcript, as demonstrated by the
co-amplification
observed in experiments using SYBR Green technology. Thus, the qRT-PCR
experiments have been carried out using the TaqMan probe-based
technology and
the 18S rRNA was used as an internal control. It has to be
underlined
that we were interested in comparing the three transcripts in the same
samples
of interest. As the expression levels of the three target genes are
largely
different and one is present in very small amounts, the experimental
conditions
resulted suboptimal in some cases, as demonstrated by the amplification
plots. Amplification
efficiencies of each
sample have been evaluated from raw data using LinReg software and show
significant differences among the targets. The amplification efficiency
of each
transcript has been estimated also by linear regression using serial
dilution.
We report our results obtained using two different methods, Q-gene and
a
combination of LinReg software and GED formula. The last methodology
has been
applied using both individual and averaged amplification efficiencies.
Furthermore, the application of the GED formula to our data results in
three
possible data combinations, that are compared and discussed. P
028 Simplified
simulation model of polymerase chain
reaction (PCR). Anneliese
Ernst1, Veronique
Creach2, Sven Becker3, Lucas J.Stal4,
Peter
M.J. Herman4. 1Fraunhofer
IGB, Email:
ern@igb.fhg.de A simplified
model of polymerase
chain reaction (PCR) is capable to describe essential characteristics
of the
amplification kinetics of this cyclic reaction. The model is based on
the
assumption that the PCR is designed and conducted in such a way that
(one) PCR
primer(s) limit(s) the formation of double-stranded PCR products. The
absence
of other limiting factors such as nucleotide limitation, enzyme
limitation or
shortage of the fluorescent dye SYBR Green® greatly reduces the
number of
parameters required to simulate real-time kinetics of individual
amplification
reactions in more explicit models. With a self-developed FORTRAN code,
we can
fit experimental data using the initial concentration of the limiting
PCR
primer to calibrate the fluorescence emitted by Sybr Green. This fit
provides a
novel method to estimate the initial concentration of target DNAs in a
PCR
sample. The method does not rely on external or internal standards. The
simulations provide explanations for the occurrence of PCR biases and
artifacts; and they are a valuable tool for teaching purposes, and in
optimizing PCR protocols. Session:
New Diagnostic
applications with qPCR
Poster
number P 029 – P
065 Location:
Student Cafeteria P
029 Application
of qRT-PCR in reproductive toxicology. Wolfgang R.
Schäfer, Wolfgang R.
Deppert, Michael Simon, Katrin Roth, Aida Hanjalic-Beck, Claudia
Nöthling,
Hedwig Austermann-Hesse, Hans Peter Zahradnik Universitäts-Frauenklinik
Freiburg, Germany Email:
wolfgang.schaefer@uniklinik-freiburg.de Drugs and
xenobiotics are known to
induce changes in gene expression which are often more sensitive and
characteristic than currently employed toxicological endpoints. We
describe the
use of quantitative real-time RT-PCR in the development of an in
vitro -test
to assess possible hazards of chemicals on endometrial functions
essential for
embryo implantation. Our work is part of the integrated project ReProTect
(EU)
developing new -in vitro_-tests which are required under the new
European
chemicals legislation (REACH) to reduce, refine or replace the use of
laboratory animals. Within the ReProTect research area of
“Implantation”
we are exploring on the mRNA level predictive toxicological endpoints
in human
endometrial explants (e.g. leukaemia inhibitory factor, LIF;
progesterone receptor;
estrogen receptor α; calcitonin; cyclooxygenase-2; corticotrophin
releasing
hormone receptor 1; VEGF-receptor 2, KDR). The goal of
the human endometrial
explants assay is to detect chemical effects on endometrial functions
which are
essential for embryo implantation. This test is a closer approach to in
vivo -conditions than primary or permanent cell cultures.
Endometrial tissues
from the proliferative and secretory phase of the menstrual cycle are
obtained
by aspiration curettage from premenopausal women. The endometrial
biopsies are
chopped into pieces of 1-2 mm/side and cultured in sex steroid
supplemented
medium without phenol red in a humidified atmosphere at 37 °C in 5
%
CO<sub>2 for 6-24 hrs. Test chemicals are administered during
this incubation
period and compared to negative controls with vehicle alone. Facing the
low tissue amounts of
human endometrial explants which are available for each incubation
(approximately 20 mg) quantitative real-time RT-PCR (LightCycler 480,
Roche) is
applied as the major analytical method. In order to identify predictive
toxicological endpoints among a larger number of target genes assays
from the
highly versatile Universal Probe Library (UPL; Roche) are used.
Evaluation is
performed by calibrator-normalized relative quantification. A status
report of
our project will be presented. It includes calibrator standard curves
for
efficiency correction, selection of housekeeping genes and preliminary
data of in
vitro -testing with the antiprogestin reference compound RU 486. This project
is funded by the European Commission ( ReProTect , Project
no.: LSHB-CT-2004-503257) P 030 Nataša Toplak1, Miha Kovač2,
Minka Kovač1, Tjaša Cerar3 and Eva Ružić Sabljić3 1Omega d.o.o.,
Dolinškova 8, 1000
Ljubljana, 2Poljane Grammar School Gimnazija Poljane,
Strossmayerjeva 1, 1000 Ljubljana and 3University of
Ljubljana,
Faculty of Medicine, Institute of Microbiology and Immunology, Zaloška
4, 1000
Ljubljana Email:
omega@omega.si Worldwide,
many infections caused by
viruses, bacteria, or parasites are known to be tick-transmitted
zoonoses.
Tick-borne diseases are a major threat to mammals and humans during
outdoor
activities in spring and fall. One of the most important tick-borne
diseases is
Lyme borreliosis caused by spirochetes within the Borrelia
burgdorferi sensu
lato complex. The different species of this group are involved in
clinical
manifestation of disease. The purpose of this study was to investigate
the
prevalence of Borrelia burgdorferi sensu lato in ticks
collected from
different regions in P
031 Composition
analysis of mesophilic mixed dairy
starters by quantitative PCR. Brockmann
E.,
Schlichter K. Chr.
Hansen A/S, Denmark Email:
elke.brockmann@dk.chr-hansen.com Mesophilic dairy
starters typically consist of
Lactococcus lactis subsp. cremoris, Lactococcus lactis subsp. lactis,
Lactococcus lactis subsp. lactis biovar. diacetilactis and Leuconostoc
species. Traditionally the total count and the percentages of
Leuconostoc spp.
and of L. lactis subsp. lactis biovar. diacetilactis have been
determined by
plate counting. Leuconostoc and L. lactis subsp. lactis biovar.
diacetilactis
percentages are of importance in the various production processes of
dairy
products manufactured with the help of mesophilic starters. Plate
counting is
laborious and often requires long incubation times before a result is
available. Therefore we developed quantitative PCR assays that allow to
specifically quantify the different components of undefined mixed dairy
starter
cultures. Most of the assays were targeted to ribosomal RNA genes.
Where assay
design was difficult because of closely related sequences, LNA
technology was
successfully applied. The poster will present aspects of assay design
and
performance for the composition analysis of mesophilic dairy starter
cultures
by quantitative PCR. P
032 Kelly Li1,
Catalin
Barbacioru1, Fiona Hyland1, Kashif A. Haque2,
Robert A. Welch2, Caifu Chen1, and
Katherine
Lazaruk1 1R&D,
Applied Biosystems, Foster
City, CA, US and 2Division of Cancer Epidemiology and
Genetics, SAIC
Frederick, National Cancer Institute, Gaithersburg, MD, US Email:
chencx@appliedbiosystems.com Gene copy
number variation is now
recognized as an important type of polymorphism in the human genome.
Gene
duplication or deletion can have a significant impact on phenotype.
Gene copy
number polymorphisms have been associated with genetic diseases such as
cancer,
immunological and neurological disorders, and have also been associated
with
variations in drug response. For example, copy number changes for drug
metabolism genes such as GSTM1, GSTT1, and CYP2D6 are known to be
associated
with variations in response to various drugs. Accurate detection of
copy number
changes is critical for understanding how gene copy number variation
plays a
role in disease or drug response. We have developed real-time
quantitative PCR
assays to quantify copy number using TaqMan® technology for a
number of genes,
including 5 important drug metabolism genes: CYP2D6, CYP2E1, CYP2A6,
GSTM1 and
GSTT1. The method involves relative quantification of the gene of
interest
versus a reference gene known to be 2 copies per diploid genome.
Relative
quantity is determined by the delta-delta Ct method, where the
endogenous
control is RNase P, and the calibrator is a DNA sample known to have 2
copies
of the gene of interest. The TaqMan-based duplex gene dosage assay is
an
accurate, robust, and reproducible method for gene copy number
detection. Here
we report the copy number results for the CYP2D6, CYP2E1, CYP2A6, GSTM1
and
GSTT1 genes using DNA samples from the International HapMap Project.
The HapMap
DNA samples come from a total of 270 individuals representing the
populations
with African, Asian, and European ancestry. There are 30 sets of trio
samples
(two parents and one child) from Yoruba people of P
033 Detailed
investigation of the retroviral life cycle
using real-time PCR assays. Steinrigl
A., Ertl R., Klein D. Vetomics Email:
Dieter.Klein@vu-wien.ac.at The
transduction efficiency of viral
vectors can easily be monitored during pre-clinical trials by inclusion
of
marker genes (Klein et al. (1997) Gene Therapy 4, 1256-1260). However,
the use
of such marker genes has to be avoided in the final clinical gene
therapy
situation since their products often represent powerful immunogens and
lead to
the elimination of transduced cells. Thus it is not desirable to use
such genes
as markers in clinical settings, especially if the vector is applied in
vivo.
In these cases PCR based methods like the real-time PCR might provide a
powerful tool to estimate biodistribution (Klein (2002) Trends in
Molecular
Medicine 8, 257-260). In order to investigate the accuracy and
precision of
this method, we have developed and tested a real-time PCR assay for the
quantification of the enhanced green fluorescent protein (EGFP) gene
and compared
the results with transduction efficiencies estimated by FACS analysis
(Klein et
al. (2000) Gene Therapy 7, 458-463). Another important topic of
retroviral
vectorology is to minimize the risk of insertional tumorgenesis. In
order to
avoid this potential risk, targeted integration into the host genome
would
increase the safety of retroviral vectors and might provide a first
step
towards gene repair. The first step towards this long-term goal is the
inhibition of the retroviral integration machinery without any
impairment of
earlier steps in the retroviral life cycle. Therefore, we constructed
several
MLV integrase mutants defective in either the catalytic centre of IN,
the
C-terminal region, or both. Viral particle production, RT-activity and
infection efficiency of the IN mutant vectors were tested in comparison
to a
vector harbouring wild type integrase in single-round transduction
assays.
Furthermore, the kinetics of reverse transcription and nuclear entry
were
analysed using a set of quantitative real-time PCR assays. While none
of the
introduced mutations seemed to substantially influence particle
production,
moderate reductions in RT-activity could be observed. Although all
mutants were
integration defective, integration was not completely abolished, which
is in
accordance with the results of other groups. Surprisingly, however,
only one
mutant, containing an almost complete deletion of the C-terminal
domain, was
impaired in the accumulation of late reverse transcription products,
while a
mutant with a similar deletion encompassing the complete C-terminus
plus part
of the catalytic domain showed normal kinetics of reverse
transcription.
Nuclear entry was not influenced by any IN mutation or deletion. These
results
corroborate the work of others stating that MLV IN, independent from
its
catalytic activity, also has an influence on reverse transcription and
suggest
that the molecular basis for this function might reside in several
discrete
parts of the protein. P
034 Kärkkäinen
P.,
Valkonen M., Nevalainen A. and
Rintala H. National
Public Health Institute,
Department of Environmental Health, Laboratory of Environmental
Microbiology, Email:
paivi.karkkainen@ktl.fi Objectives Aim of the
research is to develop a
QPCR-application for determination of Gram-positive and Gram-negative
bacteria
from environmental samples. Methodology Primers and
dual-labeled TaqMan-probes
were designed for 16S rRNA- gene location based on sequences retrieved
from
NCBI Gene Bank. In order to find possible areas for specific primers
and
probes, multiple sequences from 20 Gram-positive and 19 Gram-negative
bacterial
families were aligned first separately and then together using the
Vector NTI
AlignX software (InforMax Inc., Results Sensitivity
of the assay was not
equal for both probes, due to competition between the probes since they
bind in
same gene location in 16S rRNA. Reaction efficiency was slightly better
for the
Gram-negative probe than the Gram-positive (100 % vs. 93 %). Specificity
and reaction efficiency
of the application was tested with Bacillus cereus, Staphylococcus
aureus,
Streptomyces californicus, Mycobacterium mucogenicum, Escherichia coli,
Enterobacter aerogenes and Pseudomonas aeruginosa ,
respectively.
Some of the Gram-positive bacteria tested, Streptomyces
californicus and Mycobacterium mucogenicum , remained
undetected due to a
one base pair
difference in the middle of the probe, in contrast all three
Gram-negative
bacteria were determined successfully. All 15 different fungal strains
gave
negative results. The Ct values
for non-template
control reactions in the Gram-negative assay were consistently between
26,38
and 29,45, whereas in the Gram-positive assay they remained undetected.
This is
most probably due to background coming from the mastermix, since the
recombinant
DNA-polymerase is produced in E. coli . The background could
be avoided
by using individual reagents and a native polymerase instead of a
commercial
mastermix. P
035 Tumor
suppressor gene RBSP3 in cervical carcinoma:
copy number and transcriptional level. Anedchenko E. A. 1,
Kisseljova N. P. 2, Dmitriev A. A. 1, Kisseljov
F. L. 2.
and Zabarovsky E. R. 3, Senchenko V. N. 1 1Engelhardt
Institute of Molecular
Biology, Moscow, Russian Federation, 2Blokhin Cancer
Research
Center, Moscow, Russian Federation and 3MTC, Karolinska
Institute,
Stockholm, Sweden Email:
anedchenko@rambler.ru Chromosomal
aberrations and
expressions deficiencies in genes at the 3p21.3 region are frequently
found in
most human cancers including cervical cancer. RBSP3 (RB1
serine phosphatase
from human chromosome 3, other symbols CTDSPL , HYA22 )
is a
tumor-suppressor gene from AP20 (3p22-p21.33) region. The protein
activates pRb
by dephosphorylation and participates in negative regulation of cell
cycle. The
aim of this study was comparative analysis of RBSP3 copy
number and
transcriptional level in HPV-positive squamous cervical carcinomas
(SCC) of
I-III stages. Copy number
and mRNA level
quantification were done on 76 DNA and 59 cDNA samples from tumor and
normal
tissues using TaqMan technology and comparative or ∆∆Сt method (ABI
PRISM 7000
SDS, Applied Biosystems). All validation experiments were performed
previously.
It was shown the good reproducibility of data in the same and different
runs,
low variability of reference genes β-actin and GAPDH in
normal
and tumor tissues. We used different comparators (paired adjacent norm,
average
norm from several patients and DNA from lymphocytes) for calculations
of copy
number and transcriptional level of RBSP3 gene. We calculated
the
efficiency of all reaction for the target and references in tumor and
norm. For
this purpose we developed the program “Analysis of Expression Genes In
paired
Samples” (AEGIS) program (Reg.No. 006613816, RF). Deletions
were detected in 42% of
cases (19 of 45 studied biopsies). The frequency of deletions was
significantly
higher in SCC samples with metastases (64%) than in tumors without
metastases
(32%, P<0.05). In a few cases amplification of RBSP3 was
also found.
Altogether copy number changes of RBSP3 were detected in 51%
of cases
(23 of 45). The expression of RBSP3 was decreased in 64% of
SCC samples
(21 of 33). Again decreased expression of RBSP3 was detected
significantly more frequently (83%) in tumors with metastases compared
with SCC
without metastases (52%, P<0.05). In several cases however increased
expression was observed. Altogether changes in expression of RBSP3 were
detected in 79% (26 of 33) of SCC biopsies. Comparative analysis showed
that in
23% of SCC cases decreased expression of RBSP3 was detected in
samples
with deletions and in 36% cases such decrease was not associated with
copy
number changes. Rarely more complicated SCC cases were found. For
example in
some tumors increased expression of RBSP3 was detected in
samples with
deletions or without changes of copy number. Results of the study
suggested
that RBSP3 is involved in the progression of SCC, and there is
more than
one mechanism of its inactivation. Obtaned data can be useful for
diagnosis of
SCC. This work was
supported by the INTAS
03-51-4983 and Russian Foundation for Basic Research Grant 05-04-49408 . P
036 DETECTION
OF CIRCULATING TUMOR CELLS IN UVEAL MELANOMA
BY REAL TIME PCR. Francesca
Salvianti1, Pamela Pinzani1,
Raffaella Grifoni2, Costanza Paoletti2,
Alessandro Ciani3,
Francesca Ucci3, Cinzia Mazzini3, Bruno Neri2,
Mario Pazzagli1 1Department of
Clinical
Physiopathology, University of Florence, Italy, 2Department
of
Oncology – Centre of Experimental and Clinical Oncology, University of
Florence, Italy and 3Department of Otoneuroophtalmology,
Eye
Clinic,University of Florence, Italy Email:
m.pazzagli@dfc.unifi.it In recent
years, researchers’
interest has been focusing on investigating the importance of
circulating tumor
cells (CTC) in solid cancers as a prognostic marker, even if the
biological
significance of this phenomenon is still under debate. The Real Time
PCR
approach to detect CTCs consists in designing a set of primers and
probe
recognizing a target sequence which is tumor or tissue specific. The most
common molecular marker
used for CTCs detection in cutaneous melanoma is tyrosinase mRNA, which
is
expressed only by melanocytes and melanoma cells. In literature many
papers
deal with cutaneous melanoma, while uveal melanoma has been by far less
investigated. A high expression of melanoma-associated RNA (tyrosinase,
MART1
and gp100) has been described in patients with liver metastases from
uveal
melanoma. The objective
of our work is to
develop a method to accurately quantitate tyrosinase mRNA in blood and
evaluate
the potential of this parameter as a prognostic marker in uveal
melanoma. In
particular, we are interested in investigating the predictive value of
tyrosinase mRNA levels in case of relapse. Our purpose is also to
evaluate the
reliability of this marker in monitoring the effectiveness of therapies. Twenty
patients with uveal melanoma
(47-79 years old) were involved in this study, after receiving their
informed
consensus, and followed longitudinally for a period of about one year.
As a
negative control, 20 subjects undergoing surgery for detached retina
were
enrolled. Total RNA was isolated from whole blood by the PAXgene
technology
(PreAnalytiX). Primers and Taqman flourogenic probe for tyrosinase were
purchased from Applied Biosystems. To calculate the expression of
tyrosinase
mRNA in each sample, we referred to an external reference curve
generated with
Quantitative PCR Human Reference Total RNA (Stratagene). The method
adopted for tyrosinase
mRNA quantification was validated by means of calibration curves. These
standard
curves showed linearity over the entire quantification range (250 ng –
25 pg
total RNA). A typical standard curve equation was: y = -3.32 x + 40.47.
The
correlation coefficient was 0.99. According to
our preliminary data,
tyrosinase mRNA appears as a good candidate to become a prognostic
marker in
uveal melanoma. A significant
relationship was found
between tumour size and tyrosinase mRNA levels. Moreover an association
between
the marker and response to chemotherapy was evidenced, opening a
perspective
for its usage in monitoring therapy efficacy. Finally, patients with a
primary
involvement of the ciliary body showed a significantly higher
expression of the
marker than controls. This can be explained by the presence in this
tissue of
many blood vessels and consequently a direct release of circulating
tumour
cells. Further
studies are required to
elucidate the potential of such a molecular marker, as follow up has
been too
short to assess anything about overall surviving and disease recurrence. P
037 Development
of a highly sensitive quantitative
detection system for viable cells of Listeria monocytogenes. Petersen
A. Danisco
Deutschland GmbH, Germany Email:
antje.petersen@danisco.com Listeria
monocytogenes is an
opportunistic bacterial pathogen that accounts for significant human
food borne
diseases worldwide. The high risk of listeriosis for especially
pregnant women
and immunocomprised people require technologies that allow the
sensitive
identification and quantification of L. monocytogenes in situ.
Conventional
microbiological methods for detecting L. monocytogenes in food products
are
time-consuming. Therefore, faster DNA based quantitative polymerase
chain
reaction (qPCR) and mRNA based quantitative reverse transcription
polymerase
chain reaction (qRT-PCR) assays were developed in the present study. An analysis
of different Listeria
strains showed that the chosen primers and probes were specific for the
detection of L. monocytogenes by qPCR. Minced meat
and hotdog samples were
seeded with L. monocytogenes in the range of about 101-108 cells per
gram
sample. Samples were then processed for bacterial concentration using
high-speed centrifugation followed by DNA or RNA extraction (Stevens
and
Jaykus, 2004). The
application of the most
sensitive DNA-based assay developed in the present study achieved
quantifications as low as 1 colony-forming unit per PCR reaction. The
availability of a rapid molecular assay being able to quantify 1 CFU
per PCR
reaction is of great value for assessing the risks of food borne
listeriosis. One
disadvantage of DNA-based
methods is that they do not distinguish between living and dead cells.
This was
confirmed by spiking raw meat with DNA of L. monocytogenes that was
still
detectable after 72 h at 4°C. Among the different types of nucleic
acids
messenger RNA (mRNA) is the most promising candidate as an indicator of
viability in bacteria. In addition, we could show in the present study
that
mRNA spiked into raw meat was completely degraded after 4 h at 4°C.
Because of
the central importance of transcription for catabolism and anabolism
synthesis
of mRNA is a meaningful indicator of viability. Therefore, a
quantitative reverse
transcription PCR (qRT-PCR) strategy was established to quantify
short-living
mRNA of L. monocytogenes in food matrices. Application of the qRT-PCR
assay to
quantify L. monocytogenes cells in artificially contaminated meat
products
achieved sensitivities of 19 CFU/PCR reaction. Positive amplification
results
for prs mRNA were achieved for all replicates when 7.4 x 104 CFU/g
minced meat
or 2 x 103 CFU/g hotdog where tested in the qRT-PCR giving a linear
response
over 5 orders of magnitude. Using qRT-PCR, the number of detectable
cells of L.
monocytogenes was about 1750 CFU/g. In
conclusion, qPCR and qRT-PCR are
effective and precise technologies for the quantification of L.
monocytogenes
cells in food matrices. The developed qRT-PCR assay has already been
implemented in Danisco’s food safety development labs. P
038 Real-time
multiplex RT-PCR on circulating tumor cells. Anieta M.
Sieuwerts, Stefan
Sleijfer, Jaco Kraan, Joan Bolt-de Vries, Jan-Willem Gratama, John WM
Martens
and John A. Foekens. Department of
Medical Oncology,
Erasmus MC, Email:
a.sieuwerts@erasmusmc.nl Introduction Metastases
are thought to develop
from CTCs, tumor cells circulating in the peripheral blood. The
presence of
> 5 CTCs in 7.5 ml whole blood was found to predict clinical outcome
in
metastatic breast cancer (Cristofanilli et al., NJEM, 2004). Gene
expression
profiling of CTCs is likely to improve outcome prediction in breast
cancer as
this may yield better insight into mechanisms underlying dissemination
and drug
sensitivity. Since one human cell contains 5-10 pg total RNA and
traditional
real-time RT-PCR requires 5-20 ng RNA, a pre-amplification step is
required to
analyze expression of multiple genes. This study aimed to establish a
method to
perform mRNA expression analysis on as little as 5 CTCs in 7.5 ml whole
blood. Materials & methods Two to 20
human breast cancer cells
were spiked in 7.5 ml whole blood of healthy donors. Using the CTC kit
(CellSearch™), cells that attached to anti-EpCAM Results Of the
methods tested, the Pre-amp
method from ABI was superior in terms of homogeneous amplification of
small
amounts of mRNA. With this method all tumor-specific genes were
reproducibly
quantitated in RNA isolated from only one tumor cell. Since qRT-PCR
data from
pre-amplified RNA from 5 tumor cells clustered with non-amplified RNA
from 1000
tumor cells, pre-amplification did not compromise gene expression
profiling.
However, gene expression analysis of EpCAM purified cells isolated from
blood
of healthy donors showed that some contaminating blood cells in the
EpCAM-purified CTC-fraction exhibited mRNA expression of EpCAM and
other genes
thought to be tumor-specific. The presence of EpCAM or non-specific
EpCAM
binding to Fc receptors may account for this contamination.
Nevertheless,
already several tumor-specific genes (e.g., MUC-1 and SPDEF) could be
detected
in samples containing only 2 tumor cells spiked in 7.5 ml whole blood. Discussion & conclusion This study
shows the feasibility of
multiple gene expression analysis on RNA isolated from only one tumor
cell.
Furthermore, pre-amplification does not compromise gene-expression
profiling.
Most importantly, expression analysis of several tumor-specific genes
in blood
samples containing only 2 tumor cells is already possible. To further
optimize
CTC characterisation, additional purification steps are required to
reduce the
leukocyte contamination in EpCAM purified CTC fractions. P
039 Development
of a quantitative TaqMan LNA (“Locked
Nucleic Acid”) qPCR assay for determining viral load of HCV-infected
patients. Moreira E.S.
and Alberto F.L. Fleury
Institute, Email:
flalberto@gmail.com We developed
a real-time
quantitative RT-PCR assay for determining the viral load of HCV
infected
individuals employing TaqMan LNA probe. Tests were designed to be prone
to
automation from RNA extraction from primary PPT tubes. 400 uL of plasma
were
submitted to RNA extraction on the Qiagen 9604 Biorobot and the
isolated RNA
was re-suspended in 100 ul of Qiagen elution buffer. 20 ul was added to
each
qPCR reaction to a final volume of 50 ul with “Taqman EZ RT-PCR" kit
(Applied Biosystems). The amplified segment comprises 102 bp of the
5’untranslated region of the HCV genome. The probe, which includes 5
LNA
nucleotides, was designed with the help of the softwares “Primer
Express”
(Applied Biosystems), "LNA probe optimizer"
(http://lnatools.com/hybridization/)
and "Exiqon Tm prediction" (http://lna-tm.com/). All oligonucleotides
were checked for conservation within “HCV Sequence Database"
(http://hcv.lanl.gov/content/hcv-db/BASIC_BLAST/basic_blast.html). The
standard
curve was produced with an amplified segment of 270 bp of the same HCV
region
in vitro transcribed, purified and serial-diluted in yeast tRNA 100
ng/uL.
OptiQuant™ HCV RNA Panel (Acrometrix) was used as an external control,
which
allowed the conversion of final results from copies to IU/mL. Each
sample was
also submitted to BCR gene transcript amplification as the extraction
control.
All the assays were performed in the RotorGene 3000 (Corbett Research).
The
test detected all the HCV subtypes available (1a, 1b, 2a, 2b. 2c, 3a,
5) with
linearity from 400 to 108 IU/mL. HCV RNA was inconsistently detected in
dilutions containing less than 50 UI/mL, which was the 2 SD limit of
detection
(95% CI). As compared to other widely used methods the higher
throughput and
linearity range as well as the reduction of the contamination risk
represent a
step forward in meeting the requirements of the routine clinical
laboratory. P
040 Vester
D. 1,
Seitz C. 2,
Bettenbrock K. 2, Genzel Y. 2, Reichl U. 1,2 1Otto-von-Guericke-University
Magdeburg, Bioprocess
Engineering, Magdeburg, Germany and 2Max Planck Institute
for
Dynamics of Complex Technical Systems, Bioprocess Engineering,
Magdeburg, Germany Email:
vester@mpi-magdeburg.mpg.de Influenza
viruses cause yearly
epidemics with considerable impact on health and economics. In pandemic
years
hundreds of millions of cases occurred throughout the world with a high
rate of
mortality. To design effective antiviral drugs or vaccines for
preventing
influenza pandemics a detailed understanding of intracellular processes
of host
cells during an influenza virus infection is essential. The general
course of
events during influenza virus replication in host cells are well
understood,
but much about dynamics and control of expression of the viral genome
as well
as the transcription of the viral messenger RNAs still remains unclear. In this work,
we apply real-time PCR
to investigate the time course of human influenza A virus replication
in a
transformed MDCK (Madin Darby Canine Kidney) cell line. We designed a
two-step
technique based on a well-established and frequently used method
described for
influenza virus detection. In the first step, total cellular RNA was
extracted
from influenza virus infected MDCK cells or from cell culture
supernatant
during infection. In a second step complementary DNA was synthesized in
a
reverse transcription using polarity specific primer: producing
complementary
DNA of either viral RNA of negative polarity (vRNA(-)) or of
complementary RNA
and messenger RNA of positive polarity (cRNA(+), vmRNA(+)) for
influenza virus.
Finally, these transcripts were analysed in a quantitative real-time
PCR using
SYBR green fluorescence. Here, we
present first results in
designing and optimising this sensitive and specific two-step
quantitative
real-time PCR technique. The main
focus of future
investigations will be a comparative analysis with simulation results
of a
structured mathematical model of influenza virus replication in MDCK
cells. It
is expected that experimental results clarify basic assumption on the
control
of viral protein synthesis and viral genome replication. P
041 Differential
expression of 27 apoptosis related genes
in vitamin d-induced differentiation of HL-60 cells. KANLI A.1, SAVLI H. 2 Kocaeli
University, Turkey Email:
aylinkanli@yahoo.com Using a
quantitative real- time PCR (LightCycler), we
analyzed 27 genes ( bcl2, bcl-xl, bcl-w, mcl1, bik, bax, aif, survivin,
caspase
3, caspase 6, caspase 7, caspase 9, cytochrome C, fas, myc, TGF beta,
ERK1,
JNK1, p38 mapk, p15, p21, p27, CDK2, CDK4, Cyclin D1, Cyclin D2, Cyclin
E) for
changes in expression associated with the apoptosis of human
promyelocytic
leukemia HL-60 cells induced by 1alpha,25-dihydroxyvitamin D3 at
various time
points 18, 48 and 72h. Cells were
cultured and RNA samples were isolated.
Relative quantification data obtained from PCR products of cDNA
portions. We
did not find distinct down or up-regulated expression profiles at these
time
points. Findings suggest that there are not clear apoptotic signals in
early
phases of differentiation and the genes involved in vitamin D-induced
apoptosis
of HL-60 cells would be more clearly visible after the terminal
differentiation
process. Apoptosis and cell cycle analysis could be performed in this
experimental setting, using quantitative real- time PCR. P
042 Vincenzo
Calvanese, Aitor Sánchez-Fernández (*), Fernando
Carrasco-Ramiro (*) and Begoña Aguado Centro de
Biología Molecular Severo Ochoa (CBMSO),
Consejo Superior de Investigaciones Científicas (CSIC),
Universidad Autónoma de
Madrid, Madrid, Spain. (*) Servicio
de Genómica CBMSO Email:
fcarrasco@cbm.uam.es Alternative
splicing is described as
one of the most important ways to generate proteome complexity,
starting from a
relatively limited number of genes. Among the five main classes of
alternative
splicing, intron retention is probably the less understood. Detailed
transcriptome studies of
the Major Histocompatibility Complex (MHC) class III region genes
indicate a
high rate of different splicing events. This genomic region has a
particular
biomedical interest due to the immune-related diseases mapped in this
area,
which cannot be fully ascribed to a particular gene. There are
evidences of
disrupted regulation of splicing processes in pathology and, to study
this
phenomenon, we need analytical tools not only to identify, but also to
precisely quantify, transcripts which often differ in only few
nucleotides. We have
transcriptionally analysed
the MHC class III region LY6G5B gene, belonging to the LY6 superfamily,
mainly
composed of cysteine-rich extracellular proteins involved in cellular
interaction. Studying the LY6G5B expression in different cell lines,
tissues
and organisms, by classic RT-PCR, we found that there is an abundant
transcript
retaining the first intron of 148 nucleotides. This transcript cannot
be
translated to a protein, due to a premature stop codon, and it should
be
degraded quickly by the Non-sense Mediated Decay (NMD) machinery.
Nevertheless,
it seems to be stable and even the most abundant transcript, especially
in
tissue samples. This could indicate that this mis-spliced form is a
real
transcript which could have a potential regulatory function. This work
focuses on the design of a
real-time PCR assay to distinguish expression levels of the correctly
spliced
and the intron retained form. We optimised the primer design and the
reaction
conditions to avoid the cross-reactivity of the two transcripts. We
also
excluded the interference of genomic contamination working in parallel
on
RT-minus samples, as the intron-retaining transcript does not differ at
all
from the genomic sequence. We generated standard dilution curves, using
the two
isoforms cloned in a plasmid, to achieve an absolute quantification, in
order
to compare their absolute quantity in the same sample. Currently, with
the final
assay set-up, we are measuring the stability of the two transcripts in
different cell lines to ascertain differences on expression levels, to
later
correlate them with potential disease associations. In conclusion
we optimised a
real-time-PCR experiment designed for the differential detection of two
really
similar templates. P 043 R.
Mauritz,
R. Rein, R. Beck,
C. Goldstein Roche
Diagnostics, Roche Applied Email:
Ralf.Mauritz@Roche.com Although
quantitative real-time
RT-PCR is in principle a simple technique, the assay design remains
fairly
complex, and assays designed for specific applications often lack
sensitivity
and reproducibility. The time spent on assay design, optimization, and
validation often becomes a bottleneck in the implementation of new
assays for
large-scale expression profiling. The Universal
ProbeLibrary is a
fast, specific and flexible format for quantitative real-time PCR
experiments.
The concept is based on the fact that just 90 short probes modified
with locked
nucleic acids (LNA) provide transcriptome-wide coverage in most
organisms
(human, mouse, rat, arabidopsis, drosophila, primates and C. elegans
).
Universal ProbeLibrary probes can be designed by using a free,
web-based assay
design software, called ProbeFinder. In seconds, ProbeFinder designs
highly
specific intron-spanning assays for a target transcript. The system
allows multiple
design options, including designs for transcript variants and gene
family
members. The results
presented here
demonstrate that the Universal ProbeLibrary is now available for
relative
quantification experiments by multiplexing with housekeeping gene
assays
suitable for many real-time instruments. Additionally, new features
implemented
in the assay design software ProbeFinder conveniently integrate the
positions
of known SNPs into the assay design process, and visualize the SNP
positions on
the screen. Finally, we extended the Universal ProbeLibrary assays to
new
organisms ( e.g. , maize, rice, zebrafish) delivering the same
performance, and success rates observed in already existing organisms. P
044 Universal
ProbeLibrary – Evaluation of its Applicability
Regarding qPCR Instruments. E.
Fernholz,
D. Heisswolf, R.
Mauritz, R. Rein, O. Seth Roche
Diagnostics, Roche Applied Email:
Erhard.Fernholz@Roche.com The Universal
ProbeLibrary is a
fast, specific and flexible format for quantitative real-time PCR
experiments.
The concept is based on the fact that just 90 probes provide
transcriptome-wide
coverage in most organisms (human, mouse, rat, arabidopsis, drosophila,
primates and C. elegans ). The probes are short using the LNA
technology
to reach appropriate melting temperatures (Tm). Since each probe is
short and
can therefore bind to several locations along the DNA, the specificity
of each
assay depends on the interplay of selected primers and the Universal
Probe.
However, each assay is designed with a convenient, free of charge
web-based
assay design software, called ProbeFinder. The system facilitates
multiple
design options, including designs for transcript variants and gene
family
members. Different
PCR-programs may influence
the assays. Each qPCR-instrument has its own unique features (e.g.,
ramp
rates). Here, we evaluated the performance with different UPL-assays on
several
real-time PCR instruments. P
045 Manuel
Ammerschläger, Sandra
Ritz,
Kerstin Bieser, Andreas Holloschi, Mathias Hafner and University of
Applied Sciences,
Institute of Molecular and Cell Biology, Email:
m.ammerschlaeger@hs-mannheim.de Huntington's
Disease (HD) is a
neurodegenerative disorder caused by an abnormally expanded
polyglutamine tail
in the amino-terminal region of huntingtin (htt). Pathogenic mechanisms
involve
a gained toxicity of mutant htt and a potentially reduced
neuroprotective
function of the wild-type allele. Among the molecular abnormalities
reported,
HD cells are characterized by the presence of aggregates,
transcriptional
deregulation, altered mitochondrial membrane potential and disturbed
calcium
(Ca2+) signalling. The biological function of htt has not
been
completely elucidated. It is reported that short interfering RNA
(siRNA)-mediated inhibition of endogenous htt results in an aberrant
configuration of the endoplasmic reticulum (ER) network in vitro in
different
cell lines. We aimed to investigate htt down-regulation mediated
effects on the
ER in different human neuronal cell lines combined with gene expression
profiling of 20 different htt interaction partners. Our results
indicate that
the ER in different neuronal cell lines tested and the expression level
of
several htt interaction partners are sensitive to htt down-regulation.
Only
weak htt expression levels in Ntera2 cells were detected on basal
expression
profiles and some interaction partners like PSD95 were not or weakly
expressed
in non-neuronal HeLa cell lines. P
046 Expression
of candidate ivermectin resistance genes in
Sarcoptes scabiei. Mounsey K. 1,
Holt D. 1, McCarthy J. 2, Currie B. 1,3
and
Walton S. 1 1Menzies
School of Health Research,
Institute of Advanced Studies, Charles Darwin University, Darwin,
Australia, 2Queensland
Institute of Medical Research and Australian Centre for International
and
Tropical Health and Nutrition, University of Queensland, Brisbane,
Australia
and 3Northern Territory Clinical School, Flinders
University,
Darwin, NT, Australia Email:
kate.mounsey@menzies.edu.au Scabies is an
infectious skin
disease caused by the burrowing ectoparasitic mite Sarcoptes
scabiei .
Ivermectin is currently the treatment of choice for hyperinfested
(crusted)
scabies, and has been identified as a potentially effective acaricide
for mass
treatment programs in scabies endemic communities worldwide. Recent
reports of
ivermectin resistance in scabies mites raise concerns for the
sustainability of
such programs. It is therefore critical to define the molecular
mechanisms of
ivermectin resistance to enable early detection of emerging resistance. The objective
of this work was to
investigate the expression levels of candidate ivermectin resistance
genes from S. scabiei . These included a novel chloride
channel gene
and
representative members of the glutathione S-transferase and ABC
transporter
gene families. Mites
obtained from crusted scabies
patients were separated according to life stage and ivermectin
exposure.
qRT-PCR was performed using SYBR green for eight target genes,
amplified in
parallel with B-actin, which allowed for normalisation of varying cDNA
concentrations and assessment of inter-assay reproducibility. Data were
analysed using the relative quantification methods of Pfaffl. Glutathione
S-transferase genes were
highly expressed at all developmental stages of S. scabiei .
Expression
of the chloride channel and ABC transporter genes were comparatively
low. Of
particular interest, a multidrug resistance protein and glutathione
S-transferase were up-regulated in ivermectin exposed mites by 6 and
2.5-fold
respectively compared to non exposed mites. This increase in expression
was
most pronounced in adult female mites. The potential involvement of
these
proteins highlights a previously unexplored mechanism of ivermectin
resistance. To our
knowledge, this is the first
application of qRT-PCR to S. scabiei . Molecular studies on
this
organism have been traditionally limited due to insufficient genetic
material.
These approaches are giving us new insights into scabies mite biology
and the
basis of emerging ivermectin resistance. This may eventually assist in
overcoming many of the current difficulties in monitoring treatment
efficacy
and allow more sensitive methods for monitoring emerging resistance in
the
community. P
047 Fast
real-time PCR for the detection of tanapox virus
and yaba-like disease virus. Pia
Zimmermann 1, Ingo
Thordsen 2, Hermann Meyer (1*) (1)
Bundeswehr Institute for
Microbiology, Neuherberger Str. 11, 80927 Munich, Germany (2) Eppendorf
Vertrieb Deutschland GmbH, Peter-Henlein-Str. 2, 50389
Wesseling-Berzdorf,
Germany (*) Corresponding author: hermann1meyer@bundeswehr.org Email:
thordsen.i@eppendorf.de Agents like
tanapox virus (TPV) and
yaba-like disease virus (YLDV) may infect humans leading to symptoms
which can
be mistaken with smallpox, monkeypox, tularemia and anthrax, caused by
pathogens possibly used for deliberate bioterroristic offenses. To
ensure the
most efficient cure for infected patients and the cooperation of public
health
organisations in case of emergency, a reliable and rapid detection of
the
causative agent is of outstanding interest. We report the development
of the
first ultra fast real-time PCR assay for the detection of TPV and YLDV
using
real-time PCR instruments of the latest generation. Mastercycler®
ep realplex4
S (Eppendorf, P
048 A
Novel Multiplex, Quantitative Gene Expression
Approach for Breast Cancer Biomarker Research. Souquet M. Email:
msouquet@beckman.com Quantitative
gene expression
analysis is playing an increasingly important role in cancer research.
Currently available techniques utilize microarray analysis to detect
the
expression of a large number of genes per reaction, or alternatively,
utilize
real-time PCR to detect the expression of a few genes (at lower
throughput). A
multiplex approach to analyze a specific set of genes from a given
biological
pathway in a single reaction using a limited amount of RNA is of great
interest
to cancer biologists. To address this demand, the GenomeLab™ GeXP
Genetic
Analysis System was developed. This system utilizes eXpress Profiling
technology, a highly multiplexed PCR approach to quickly and
efficiently
analyze the expression of 20-30 genes with high sensitivity. The
throughput is
scalable to over 6000 gene expression results per day. Here we present
a study
using a GeXP-designed marker panel of 29 genes whose functions are
directly or
indirectly related to breast cancer formation. Our study demonstrates
that this
approach can quantitatively detect the expression of the genes in this
multiplex cancer panel in a single reaction using as little as 25 ng of
total
RNA isolated from human breast cancer tissues. The GeXP system can also
be used
to design custom multiplex panels to evaluate biological pathways
involved in
other forms of cancer. The GenomeLab GeXP Genetic Analysis System is a
cost-effective way of performing multiplex gene expression analysis
with
scalable throughput capacity, high assay robustness, and excellent data
quality. P
049 1Institute of
Biochemistry and
Experimental Oncolgy, 1st Faculty of Medicine, Charles University in
Prague,
Czech Repbulic, 2Dept. of Obstetrics and Gynecology 1st
Faculty of
Medicine, Charles University in Prague and General Faculty Hospital,
Czech
Republic and 33rd Dept. of Medicine 1st Faculty of
Medicine, Charles
University in Prague and General Faculty Hospital, Czech Republic Email:
pekleje@lf1.cuni.cz Gestational
diabetes mellitus (GDM)
is the condition of glucose intolerance appearing in woman usually in
the
second trimester of pregnancy with prevalence 5-7% of pregnancies
worldwide.
GDM is considered to be an independent risk factor for subsequent type
2
diabetes mellitus development. The aim of our study was to characterize
expression
profile of genes participating to the energy metabolism regulations in
adipose
tissue pre-selected by gene expression array. METHODS: The
women with single
pregnancy parturient by Caesarean section were enrolled into the study.
All
subjects gave the informed consent approved by local ethical committee.
Subcutaneous and visceral (omental) adipose tissue samples were
obtained during
surgery from each of analyzed subjects: 15 women with GDM (9 treated by
RESULTS: The
most apparent changes
in visceral adipose tissue of pregnant women with GDM involved
up-regulation of
NOS2A (NO-synthase 2A) mRNA (2.4x; p=0.0125) and down-regulation of PRL
(prolactin) (11.5x; p=0.0165) and IGFBP1 (IGF-binding protein 1) (59x;
p=0.003)
comparing to healthy cohort. Moreover, in subgroup of obese pregnant
women with
GDM (BMI>30 kg.m-2 at the 3rd day after the delivery) the pronounced
decrease of expression of PRL (25x; p=0.008) and IGFBP1 (194x;
p=0.003),
together with decreased expression of IRS2 (insulin receptor substrate
2)
(1.5x; p=0.0425) was found (comparing to healthy controls). In
subcutaneous adipose tissue of
GDM patients the two-fold increase of LDLR (LDL receptor) (p=0,0065)
was found.
In a sub-group of pregnant women with GDM treated by insulin the
down-regulation of IRS2 (1.7x; p=0.044) was detected. CONCLUSIONS:
The current results
indicate 1) substantial alteration of gene expression of insulin
pathway
regulators in GDM patients; 2) differential involvement of
subcutaneous/visceral adipose tissues on the pathogenesis of GDM.
Currently
running prospective study will score the ability of gene expression
profiling
for the early diagnostics of the type 2 DM risk development in GDM
patients. ACKNOWLEDGMENT:
Supported by IGA
MZCR 8302-5 and Research project MSM 0021620814. P
050 Host
responsiveness during low dose infection with
different strains of BCG. Tania Di
Pietrantonio 1, 2,
Manon Girard 1, Annie Verville 1, Marianna O.
Orlova 1,
Adam Belley 1, Marcel A Behr 1,3 and Erwin
Schurr 1,2,3. 1Centre for
the Study of Host
Resistance, McGill University, Montreal, Quebec, Canada, H3G 1A4, 2Department
of Human Genetics, McGill University, Montreal, Quebec, Canada, H3A 1B1
and 3Department
of Medicine, McGill University, Montreal, Quebec, Canada, H3G 1Y6 Email:
tania.dipietrantonio@mail.mcgill.ca RATIONALE: The
anti-tuberculosis vaccine Mycobacterium bovis Bacille Calmette
Guérin (BCG), is a widely administered vaccine despite its
variable protective
efficacy. Since BCG substrains differ in their production of
antigenic proteins,
it is possible that strain-specific components are involved in the
quality of
host response mechanisms. Here, we investigated host responsiveness to
three
strains of BCG in two mouse strains with contrasting innate
susceptibilities to
BCG. EXPERIMENTAL APPROACH: A/J and
C57BL/6J mice were infected intravenously at
8 to 10 weeks of age with approximately 104 colony forming
units
(CFU) of BCG Russia, RESULTS: Among the
three BCG substrains tested, BCG Pasteur
stimulated the largest production of interferon gamma (Ifng). BCG
Pasteur,
which grew progressively better in the spleens of the C57BL/6J strain
at day
21, also preferentially induced higher levels of both Ifng and
interleukin-12b
(Il12b) in this mouse strain. Although continuous growth was observed
for BCG
Russia in the lung and spleens of both host strains, induction of Ifng
and
Il12b was observed in C57BL/6J animals only. Infection with BCG Japan,
which
was characterized by markedly low splenic bacterial load and an absence
of
pulmonary bacterial growth, failed to evoke an immune response in both
strains
of mice. Differences in the production of interleukin-4 (Il4) across
BCG
strains were not observed. CONCLUSION: Employing
quantitative PCR, we determined that
genetically heterogeneous strains of BCG elicit different host immune
responses. Using comparative genome analysis of BCG strains, it may be
possible
to correlate these distinct host response traits with specific
bacterial genome
elements. P
051 Lorenz A1, Hoelscher M1,
Gerhardt M2, Minja F2, Morris-Jones S3,
Zumla
A3, Huggett J3 1Department of
Tropical Medicine and
Infectious Diseases, Ludwig Maximilian University, Munich, Germany, 2Mbeya
Medical Research Programme, Mbeya P.O. Box 2410, Tanzania and 3Centre
for Infectious Diseases and International Health, University College
London, UK Email:
Andreas.Lorenz@campus.lmu.de Tuberculosis
(TB) kills roughly four
people every minute and represents a major global health problem.
Despite this
fact diagnosis relies on antiquate methods like sputum stain
microscopy,
culture or empirical assessment. With the exception of culture (which
typically
takes six weeks), the efficacy of the available diagnostic methods are
both
poor and highly variable. Nucleic Acid Amplification Techniques have
not broken
this trend despite the existence of a number of commercially available
methods.
A major reason for this is the lack of comprehensive optimisation when
“in
house” methods have been used. Optimisation steps have not always been
applied
to all the stages required to store, process and assess a clinical
specimen.
The most common specimen, when diagnosing TB, is sputum, which can be
highly
heterogeneous and difficult for nucleic acid extraction. We are
interested in
the use of urine for molecular diagnosis of TB. Urine represents the
ideal
clinical sample as it is easy to collect, with minimal risk of
infection. There
are a number of studies describing the detection of Mycobacterium
tuberculosis (Mtb) DNA from TB patients using PCR. However they
suffer from
the same optimisation criticisms mentioned above. The nucleic acid
extraction
methods where not tested for the recovery of DNA from urine or the
removal of
inhibitors that may disrupt the PCR reaction. Furthermore none of these
studies
consider that the target DNA is likely to be part of the Circulating
Nucleic
Acids in Plasma and Serum (CNAPS). From which molecules of ≤150 bp are
reported
to cross the kidney barrier and to be found in urine as transrenal DNA
(trDNA).
Consequently for efficient detection of these molecules PCR reactions
with
amplicons of <150 bp are desirable. We have developed an Mtb complex
specific qPCR assay which will be assessed for diagnostic utility.
However
before such an assessment can be made the pre-PCR steps have to be
optimised. The
work described here aims to establish an efficient method for
extracting trDNA
from urine. We have spiked urine from a number of healthy male donors
with
different sized Mtb DNA sequences. By re-extracting these DNA molecules
using a
number of different DNA extraction methods we aim to investigate their
respective efficacies for both DNA recovery and the removal of
inhibitors.
Identification of an efficient trDNA extraction procedure will enable
us to
accurately assess the utility of targeting Mtb trDNA as a diagnostic
method for
TB. P
052 Monitoring
of Resistance Genes during Antibiotic
Therapy of Pigs. Hölzel
C., Bauer
J. TU
München, Lehrstuhl für Tierhygiene, Germany Email:
christina.hoelzel@wzw.tum.de Tetracyclines
are the most common
antibiotics in livestock farming. The correlation between application
of
antibiotics and spread of antibiotic resistance is beyond question, but
hard to
quantify. Thus a quantification method for tet(M) and tet(O) in pig
liquid
manure was established. In a first approach, we tried to follow the
rise of
tetracycline resistance genes in faeces during oral application of
chlortetracycline (CTC) to pigs. Material and
Methods For the
evaluation, liquid manure
from antibiotic free raised pigs was treated by x-rays (up to 409 kGy)
in a 60Co-radiation-facility
in order to destroy bacterial resistance genes. This pre-treated manure
was
artificially contaminated with different concentrations of Bacillus
“R89” which
posseses exactly one copy of tet(M)/cell. DNA extraction was carried
out with
PowerSoilTM DNA-Isolation Kit. The content of tet(M) was analysed by
means of
real-time PCR (Light Cycler®, Roche; detection mode:
SYBR®GreenI). Recovery
rates were determined by comparing the number of copies analysed versus
the
number of copies added. The course of
the number of tet(O)
and tet(M) in the faeces during the application of CTC (20 mg/kg body
weight)
was studied in two different trials (A/B). In trial A, samples of
faeces of 6
antibiotic free reared pigs were examined for tet(O) before, during and
after
the application of CTC. In trial B, 2 groups of pigs (n=5) were fed a
CTC-containing and a CTC-free diet, respectively. Each pig was kept in
a
metabolic cage within the same stable. Faeces were analysed daily for
the
content of tet(M)-copies using qPCR. Results Exposure to
x-rays reduced the
tet(M) content in the manure by one order of magnitude per 54 kGy. The
analysis
of the artificially contaminated samples (103 to 107
copies per capillary) showed recovery rates from 15.8 to 26.7 % with a
standard
deviation between 0.4 and 14.3 %. The
medication of pigs with CTC
(trial A) resulted in a significant increase of tet(O) copies in faeces
from
6.92 log10/g at the beginning to a maximum of 8.45 log10/g
at day 6 of the withdrawal period. The decrease of the copies during
the
withdrawal period was very slow; at the end a concentration of 7.66 log10/g
was still measured. In trial B,
the numbers of tet(M)
copies in the faeces of the medicated pigs lay nearly one order of
magnitude
higher than those of the control (8.31 vs. 7.46 log10/g).
However,
the course of the mean values of the control group was nearly parallel
to that
of the treated group, indicating a transfer of resistant bacteria via
air and
dust. Future
prospects Monitoring of
resistance genes
during and after application of distinct antibiotics enables to assess
the
particular selection potency of the antimicrobial agent. Thus, it might
offer
interesting information for decisions of choice between equally
effective
antibiotics as well as for decisions of market authorization. P
053 Silvia Calatroni, Barbara Rocca,
Ilaria Giardini, Marina Boni, Irene Dambruoso, Paolo Tarantino, Paolo
Bernasconi Division of
Hematology - IRCCS
Policlinico S. Matteo Foundation, Email:
s.calatroni@smatteo.pv.it The molecular
signature of BCR-ABL
fusion gene in chronic myeloid leukemia (CML) provides a unique tool
for
diagnosis and monitoring of tumor burden during therapy. The
introduction of
imatinib mesylate, allowing the achievement of high rates of clinical
and
cytogenetic remission, has revolutionized the treatment of CML patients
and
reinforced the fundamental role of BCR-ABL transcript levels monitoring
by
RT-qPCR to assess minimal residual disease. Nevertheless, many
procedural
aspects of this complex technique require a strong inter-laboratory
optimisation and recommendations for harmonizing the different
methodologies
have recently been proposed. The Xpert BCR-ABL MonitorTM, recently
developed by
Cepheid ( P
054 qPCR
BASED DETECTION OF DIFFERENT ROTAVIRUS GENOTYPES
FROM STOOL SAMPLES IN A SINGLE EXPERIMENT. Ion
Gutierrez-Aguirre1, Andrej
Steyer2,
Mateja Poljšak-Prijatelj2, Jana Boben1, Kristina
Gruden1
and Maja Ravnikar1 1Department of
Plant Physiology and
Biotechnology, National Institute of Biology, Ljubljana, Slovenia and 2Institute
for microbiology and immunology, Faculty of medicine, University of
Ljubljana,
Ljubljana, Slovenia Email:
ion.gutierrez@nib.si Rotaviruses
are the major cause of
acute diarrhea in animals, infants and children under 5 years old. They
are
unenveloped viral particles with three proteinaceous layers and their
genome
consists of 11 dsRNA segments. Six structural proteins (VP1–VP4, VP6
and VP7)
and six non-structural proteins (NSP1–NSP6) are encoded in the viral
genome.
Rotaviruses are classified into 7 groups (A–G) based on the antigen
specificity
of the VP6 gene. The most common is group A, infecting both humans and
animals.
According to the VP4 and VP7 antigenic and molecular characterization,
group A
rotaviruses are further classified into different p and g types. The
most
frequent genotype combinations in humans are G1 P[8], G2 P[4], G3 P[8],
G4 P[8]
and G9 P[8]. These are also the most predominant global genotypes. In case of
natural disasters, i.e.,
earthquakes, floods, etc., fecal waters can mix with potable waters.
Rotaviruses can then, along with other pathogenic agents, be present in
water
supplies constituting a possible risk for the population. The
development of a fast
and sensitive qPCR detection method which could detect very low
rotavirus
concentrations and cover as many rotavirus genotypes as possible would
help to
prevent such risks. We have
designed a qPCR TaqMan
approach targeted to the VP2 gene, based on a multi-sequence alignment
of 7
different human rotaviral strains. To overcome the high nucleotide
sequence
diversity within the different rotaviral strains, multiple forward and
reverse
primers were designed in addition to a MGB TaqMan probe. The approach
was
tested on seven infected stool samples, each containing one of the
following
genotypes: G1 P[8], G2 P[4], G3 P[8], G4 P[8], G8 P[8], G9 P[8], and
G12 P[8].
A sample containing a mixture of all seven genotypes was also tested.
Initial
concentration of samples was assessed by electron microscope counting
using
latex beads of known size and concentration. Three different RNA
isolation
procedures were tested: TRIzol, thermal denaturation and the magnet
bead based
King Fisher method. RT-qPCR was performed in two separate steps.
Preliminary
results show that we are able to detect rotavirus genotypes that
significantly
differ at the sequence level. Limit of detection for the method used is
acceptable with ≥90% efficiency values. This approach will be used in
future
attempts to detect the presence of rotaviruses in water samples. P
055 Quantification
of live bacteria by quantitative PCR. Bennedsen M., Koivalo S. Chr. Hansen A/S,
Denmark Email:
mads.bennedsen@dk.chr-hansen.com Quantitative
PCR is a powerful tool
for studying population dynamics of bacteria in complex samples, e.g.
the
population dynamics of starter cultures in cheese ripening. The major
drawback
of the use of PCR based methods is, that it measures genomes regardless
of the
viability of the bacteria. Unfortunately DNA of killed bacteria is
stable for
weeks in biological samples, compromizing the quality of the qPCR based
data. A
method for distinguishing live and dead Gram negative bacteria has
previously
been published (Rudi et al 2004) In the
present work we describe
methods for enumeration of live Gram positive bacteria, using one of
two
reagents: Ethidium monoazide bromide (EMA) and propidium monoazide
iodide
(PMA). EMA treatment
of live and dead Lactobacillus
sp show a reproducible shift of 10 Ct of the dead bacteria as
compared to
the live bacteria, corresponding to a reduction of the signal from dead
bacteria by 99,9%. P
056 QUANTIFICATION
OF SPLICE VARIANTS USING REAL-TIME PCR
AND ITS APPLICATION IN THE STUDY OF DISEASES. Olatz Villate1, Aitor
Sánchez-Fernández 2, Fernando Carrasco-Ramiro
2 and
Begoña Aguado1 1Centro de
Biología Molecular Severo
Ochoa (CBMSO), Consejo Superior de Investigaciones Científicas
(CSIC)-Universidad Autónoma de Madrid, Madrid, Spain and 2Servicio
de Genómica CBMSO Email:
oli_bio@hotmail.com Alternative
mRNA splicing is a
complex post-transcriptional mechanism. It enables the generation of
different
mRNA isoforms from the same primary transcript, allowing a large
diversity of
proteins to be synthesised from a relatively small number of genes.
There is a
growing interest in precisely quantify splice variants expression. In
addition,
alteration of normal splicing events can cause or modify human disease.
For
this, a reliable method for measuring the expression levels of splice
variants
is an important step in investigating the significance of each isoform.
Quantitative real-time PCR is the most sensitive method to ascertain
gene
expression levels that has been developed to date. Our aim is to
applicate real-time
PCR technology to quantify the different splice variants generated by
genes,
located in the Major Histocompatibility Complex class III region, which
are
potentially implicated in diseases. We are now focusing in the NFKBIL1
( nuclear factor of kappa light polypeptide gene enhancer
in
B-cells
inhibitor-like 1 ) gene, which is a susceptibility gene for
developing
reumatoid arthritis. It encodes a protein resembling members of the
IkappaB
protein family that regulate bioavailability of NFkappaB. We have
identified
two splice variants of this gene, which differ on the 5´UTR. Here we
describe the design of a
real-time PCR assay that differentiates these two variants using a
TaqMan probe
and the use of a method which creates reliable standard curves using
plasmids
containing the alternative transcripts. To start, we have set up this
method in
cell lines and have observed that the representative transcript is the
mainly
expressed in Raji cells (78%) and in Hek293 cells (86%), corresponding
to human
B and embrionary kidney cells, respectively. As this NFKBIL1
gene can be
involved in the development of reumatoid arthritis, we now want to
quantify
whether the ratio of the splicing isoforms might change among patients
and/or
correlates with disease severity. We are beginning to analyse mRNA
extracted
from blood and synovial fluid samples of patients with reumatoid
arthritis and
blood mRNAs from controls. We want to applicate this technology to the
study of
another genes potentially implicated in diseases. P
057 Nadal A.1;
Aldeguer X.2; Coll A.1;
Gonzàlez-Huix F.2; Acero D.2 and Pla M.1 (1) Institut de
Tecnologia Agroalimentària, Universitat
de Girona, Spain (2) Servei de Cirurgia General i Aparell Digestiu,
Hospital
Universitari Josep Trueta, Girona, Spain Email:
anna.coll@udg.es Probiotics
and prebiotics have been
reported to have beneficial effects on human health in various clinical
situations; and to act through diverse mechanisms such as direct
effects in the
intestinal lumen, or indirect effects by modulation of the endogenous
microflora or of the immune system (Marteau et al., 2004). Four
different
lactic acid bacteria (LAB) strains obtained from ecologic cultivated
rye and
oats were chosen for use in a synbiotic formula ( Synbiotic 2000 )
due
to their strong bioactivity and resistance to gastric and bile acids
(Kruszewska et al., 2002). Recent results show that this synbiotic
formula
leads to significant clinical improvement to certain types of patients
(Pathmakanthan et al., 2002); and further prospective assays are
currently
taking place (financed by the Fundació LaMarató de TV3). Aiming at the
quantitative
traceability of the four LAB in Synbiotic 2000 , real-time PCR
(QPCR)
assays were designed and optimised for the specific detection and
quantification of each LAB in colon biopsies. Sequences from luxS ,
putative pheromone pcrA , kinase acetate and collagen adhesion
1158 genes
were selected as QPCR targets. They all fit the following criteria i.e.
(i)
display percentages of homology below 70% among the target LAB species
and
other sequences in gene databases; and (ii) exhibit complete homology
to all
sequences from different strains of the same species or subspecies. A total of 78
bacterial (mainly LAB)
stranis were assayed and the four QPCR assays proved fully specific and
highly
sensitive, with detection limits of 10 target molecules per reaction
with 95%
probability. The assay was linear along 6 orders of magnitude (R2 >
0.99)
and accurate quantification was possible down to a limit of around 30
target
molecules. Comparison of the results obtained by QPCR and standard
microbiological methods showed an excellent relative accuracy. The
assay was further
adapted to the analysis of colon biopsies by incorporation of a pre-PCR
treatment; and proved capable to accurately quantify down to 100 target
LAB
cells per biopsie with detection limit of 10 cells (30 % probability). We used the
developed QPCR assays to
show the colon colonisation by the 4 LABs. Additionaly we concluded
that the
developed QPCR assays were a valuable tool for on-going studies of
probiotics
colonization dynamics. Kruszewska D,
Lan JG, Lorca G et al. Selection of
lactic acid bacteria as probiotic strains by in vitro tests.
Microecology and
Therapy 2002; 29: 37-51. Marteau P,
Seksik P, Lepage P and
Dore J. Cellular and physiological effects of probiotics and prebiotics
Mini
Rev Med Chem. 2004; 4(8):889-96. Pathmakanthan
S, Walsh M, Bengmark S
et al. Efficacy and Tolerability treating acute distal ulcerative
colitis with
Synbiotic enemas: A Pilot Trial. Gut 2002; 51:A307. P
058 Rapid
and sensitive detection of infectious poxvirus
particles. Andreas
Nitsche,
Daniel Stern and
Georg Pauli Robert
Koch-Institut, Germany Email:
nitschea@rki.de Since the
anthrax spore attacks
occurred in fall 2001 in the P
059 Real-time
PCR in diagnostics of plant viruses. Mehle
N., Boben
J., Ravnikar M. National
Institute of Email:
natasa.mehle@nib.si For
identification of plant viruses
ELISA, immuno-serological electron microscopy, test plants and RT-PCR
or PCR
are frequently in use. Recently, a more sensitive and specific method
real-time
PCR was developed for diagnostics of certain plant viruses. Real-time
PCR can
be used for determination of different viruses as well as for
differentiation
between related strains of viruses. The method can also be used for
detection
of low concentrations of plant viruses in various samples such as
environmental
waters, growth substrates, and seeds. In our
laboratory real-time PCR was
developed for identification of Chrysanthemum stem necrosis virus (CSNV).
The method for detection of serologically closely related Tospovirus Tomato
spotted wilt virus (TSWV) (Boonham et al., 2002) was successfully
implemented in the diagnostic procedures. Previously we demonstrated
that CSNV
serologically cross-reacts with many commercially available antisera
against
TSWV in ELISA assay and that the symptoms on chrysanthemum are very
similar in
both, CSNV and TSWV (Ravnikar et al., 2004). Real-time PCR used alone
or in
combination with other methods is a way for efficient and reliable
detection
and differentiation of this two Tospoviruses. Concentration
of plant viruses in
irrigation waters and soil is usually below the sensitivity of
frequently used
detection methods such as ELISA. Real-time PCR for identification of Tomato
mosaic virus (ToMV) in tomato and tobacco plants, irrigation
waters and
soil was developed. The method was shown to be 1000 times more
sensitive than
ELISA (Boben et al., 2006). Real time PCR was also shown to be more
sensitive
than other methods in detection of Potato virus Y (PVY) in
potato leaves
(Mehle et al., 2004). In real-time
PCR reactions used for
detection of viral presence in the plant material the internal controls
18S or
COX (Boonham, personal communication) were included in the assays in
order to
control the RNA extraction procedure. Reverse transcription step was
performed
separately or one-step real-time RT-PCR was performed and compared with
two-step assay. P
060 Alfred
Schöller1,3, Christa
Freibauer1,3, Eva-Maria Dlouhy-Schütz2,3,
Min Wang4,
Youji Hu4, Mark Stearns4, Gerhard Lunglmayr3 1Institute of
Clinical Pathology, LK
Weinviertel Mistelbach, Austria, 2Department of Urology, LK
Weinviertel Mistelbach, Austria, 3Karl Landsteiner
Institute for
Andrology and Prostate Research, LK Weinviertel Mistelbach, Austria and
4Department
of Pathology and Laboratory Medicine, Drexel University, Philadelphia,
USA Email:
alfred.schoeller@mistelbach.lknoe.at Objectives: In the last
ten years hundreds of genes which are
over-/under-expressed or specifically produced in prostate cancer
tissue have
been discovered. The growing prostate tumor exfoliates cells
(molecules) into
spontaneous urine via the urethra during natural
shedding/apoptosis/lysis. In
addition the number of released prostate cells can be increased by an
attentive
digital rectal examination (DRE) prior to urine collection. Diagnostic
urine
real time PCR assays have been developed recently (specific mRNAs:
PCA3, AMACR,
TMPRSS2:ERGa fusion gene). In our long term research program we address
the
question if quantitative information on selected prostate cancer
biomarker
mRNAs can be extracted from a heterogeneous urine cell fraction by real
time
qPCR. Furthermore, we explore if urine qPCR data can be used for a
comprehensive non-invasive prostate tumor survey (differentiation
latent/clinical tumor, malignancy, progression, metastasis, relapse,
survival). Methods: Urinary
cells were isolated by filtration (50ml; n=42
urine from pathologically confirmed prostate cancer patients; n=36
urine
samples from males aged <35 years as negative controls; additionally
urine
was collected from patients prior and after an attentive DRE). Total
RNA was
isolated from lysed cells (Zymo Research urine RNA isolation kit) and
reverse
transcribed into cDNA using anchored primers (Roche Transcriptor Kit).
Quality
control was performed by Lightcycler II real time SYBR Green I PCR with
a 18s
RNA primer pair. A geNORM and Normfinder analysis was performed with 15
housekeeping genes (PrimerDesign Ltd.) with RNA samples in duplicate
reactions.
A panel of 12 mRNAs known to be over-expressed in prostate cancer was
quantified after correction for PCR efficiencies. GenEx software
(MultiD) was
used for calculations and statistical data analyses. Results: A cell
filtration assay allows highly efficient,
inhibitor free total RNA isolation from spontaneous and post-DRE urine.
Urine
cell filtrates contain a mixture of kidney, bladder, prostate, urethral
epithelial cells and leukocytes of unknown percentage composition.
Hence, a
relative mRNA quantification strategy has to be based on mRNAs of
reference
genes which are stable expressed in normal and cancer or pre- and
post-DRE
urine. A geNORM/Normfinder analysis identified GAPDH and CYC1 as the
two best
overall fitted genes for a prostate cancer urine mRNA analysis.
Subsequently
Lightcycler II SYBR Green assays were performed for 12 prostate cancer
tumor
marker genes (ABCA5, AMACR, DD3/PCA3, PCa-002, PCGEM1, PSA, PSCA, PSGR,
PSMA,
RPS2, TMPRSS2, TMPRSS2:ERGa). Results of relative Lightcycler real time
qPCR
assays with selected biomarker mRNAs will be presented. Conclusions: Prostate
cancer tumor marker mRNAs can be quantified
in spontaneous and post-DRE urine of non-diseased and prostate cancer
patients
by real time qPCR. Multi-parameter qPCR assays might in the near future
supplement the urological diagnosis (OENB P11491). P
061 Selection
of reference genes in real-time RT-PCR
studies of Atlantic salmon Salmo salar. Pål A.
Olsvik1, Kai K. Lie1,
Ann-Elise O. Jordal2, Tom O. Nilsen2 and Ivar
Hordvik2 1National Email:
pal.olsvik@nifes.no Salmonid
fishes are among the most
widely studied model fish species but only limited information is
available on
reference gene stability in qRT-PCR studies. The stability
of six potential
reference genes was examined in eight tissues of Atlantic salmon (Salmo
salar),
to determine the most suitable genes to be used in quantitative
real-time RT-PCR
analyses. The relative transcription levels of genes encoding 18S rRNA,
S20
ribosomal protein, β-actin, glyceraldehyde-3P-dehydrogenase (GAPDH),
and two
paralog genes encoding elongation factor 1A (EF1AA and EF1AB)
were quantified in gills, liver, head kidney, spleen, thymus, brain,
muscle,
and posterior intestine in six untreated adult fish, in addition to a
group of
individuals that went through smoltification. Based on calculations
performed
with the geNorm VBA applet, which determines the most stable genes from
a set
of tested genes in a given cDNA sample, the ranking of the examined
genes in
adult Atlantic salmon was EF1AB>EF1AA>β-actin>18S
rRNA>S20>GAPDH. When the same calculations were done on a total
of 24
individuals from four stages in the smoltification process (presmolt,
smolt,
smoltified seawater and desmoltified freshwater), the gene ranking was
EF1AB>EF1AA>S20>β-actin>18S
rRNA>GAPDH. We are further evaluating the usefulness of elongation
factor
paralog genes as potential reference genes in Atlantic salmon. In
current
examinations, two new paralogs, EF1AC and EF1AD,
are also
studied, and the stability of these forms compared to EF1AA
and EF1AB.
Overall, this work suggests that the EF1AA and EF1AB
genes can be useful as reference genes in qRT-PCR examination of gene
expression in the Atlantic salmon. The
SPUD assay has an important role in interpretation
of detecting Pneumocystis DNA in clinical specimens. Novak T1.,
R.F. Miller1,
A. Pooran1, M. Hoelscher2,3, M. Gerhardt2,
F.
Minja2, A. Zumla1, J. Huggett1 Email:
t.novak@ucl.ac.uk Pneumocystis pneumonia
(PCP)
is the most frequent AIDS-defining disease associated with an
opportunistic
pathogen. Identification of the causative agent, Pneumocystis
jirovecii ,
in clinical samples requires a complicated microscopic procedure
demanding
considerable histological expertise. There is clear potential benefit
in use of
molecular methods to diagnose and monitor PCP, yet the utility of PCR
remains
uncertain despite the existence of substantial published work
addressing this
subject. One of the reasons for this uncertainty is that a negative PCR
result
does not always infer the absence of target ( Pneumocystis )
DNA in a
clinical sample - unless that sample is assessed for the presence of
PCR
inhibitors. The problem lies in the fact that clinical samples may be
highly
heterogeneous, containing variable amounts of both host and pathogen
DNA, as
well as inhibitory substances which may be extracted alongside the
intended
target template. Inhibited specimens may be reported as ‘PCR negative’,
when in
fact they are ‘false negatives’ so compromise diagnostic sensitivity.
It is
essential to include an assessment of sample inhibition to provide
confidence
in interpretation of molecular detection. The SPUD inhibitor assay,
using
potato DNA, has been used previously to assess inhibition of PCR in
cDNA
samples. We have used the same strategy to measure PCR inhibition in
clinical
samples when assessing the presence of P. jirovecii DNA. By
artificially
including the SPUD amplicon in real-time qPCR reactions we have
investigated
whether a clinical sample is causing inhibition. We are characterising
use of
the SPUD inhibitor assay for routine assessment of DNA extracts from a
range of
clinical samples (including urine, bronchoalveolar lavage fluid and
pleural
fluid). This assay has the potential to provide valuable information
enabling
better interpretation of a negative result and aiding identification of
specimens that need additional assessment. P
063 Use
of real-time RT-PCR as a substitute for nuclear
run-on transcription assays. Pennington C. J. and
Edwards
D.R. Email:
c.j.pennington@uea.ac.uk Tissue
inhibitors of
metalloproteinases (TIMPs) are a family of four multifunctional
proteins with a
broad range of biological activities, including inhibition of
metalloproteinase
activity, regulation of cell proliferation, apoptosis and the
regulation of
angiogenic and inflammatory responses. Elevated mRNA expression of TIMP
family
members correlates with malignancy and clinical outcome in many human
cancer
types; however, a protective role for TIMPs has also been observed in
various
mouse models of human cancer. Mammalian TIMP2, TIMP3 and TIMP4 genes
contain 5
exons but TIMP1 has an additional short first exon which is transcribed
but not
translated; the translation start site is located in exon 2 and these
two exons
are separated by an 646bp intron 1 region that is therefore unique to
TIMP1
genes. Previous studies have shown that the control of TIMP1 expression
occurs
at the level of transcription with regulatory elements present in the
promoter
region and in the first intron prior to the translational start site
(Dean et
al, J. Biol. Chem. 2000:275 p32664-32671). We demonstrate using nuclear
run on
assays and a novel TaqMan based analysis to quantify transcription
levels, that
Timp1 transcription following stimulation of 10T1/2 mouse fibroblast
cells by
PMA and growth factors is not uniform across the gene. Real Time PCR
probes,
located in different introns throughout Timp1, revealed a marked
decrease in
gene transcription of intron 1 after +570. Analysis using 3’-RACE
further
indicates the presence of primary transcripts that terminate at various
sites
towards the 3’-end of intron-1. These data indicate that Timp1 but not
other
Timp family members, is subject to control by transcriptional
attenuation
within its distinctive intron1 region. Further work will concentrate on
the
mechanism of transcription attenuation and the possible role played by
chromatin remodeling. P
064 High
Resolution Melt analysis with non-saturating
dyes. Jason
Barrett, Paul Kayser, Natalie
Simpson, Winnie Chong, Mark Stevens 1Quantace, Email:
info@quantace.com High
resolution melt (HRM) analysis
is a rapidly developing technique for mutation detection based on the
temperature dissociation characteristics of DNA. Development of the
technique
has relied on the continued evolution of fluorescent binding dyes.
These
"Third-Generation" dyes include LC Green+, SYTO9 and EvaGreen.
Previous comparative experiments of these dyes with SYBR Green I
identified the
importance of saturating dye concentrations in reducing dye
redistribution. It
has been postulated that dye redistribution leads to a decrease in
sensitivity
and therefore reduced confidence in mutation calling. We have shown
that LC
Green+, SYTO9, EvaGreen and SYBR Green I are not saturating at
concentrations
non-inhibitory for PCR. EvaGreen, although non-saturating, successfully
detects
class IV mutations. These results lead to the conclusion that
dye-chemistries,
and not saturation per se are important principles that need to be
addressed
for successful HRM analysis. P
065 Gene
Expression Signature in Peripheral Blood Detects
Thoracic Aortic Aneurysm. Samaha R. Applied Email:
samaharr@appliedbiosystems.com Thoracic
aortic aneurysm (TAA) is
usually asymptomatic and associated with high mortality. Although
adverse
clinical outcome is preventable by surgical repair, identifying at-risk
individuals is difficult. Our goal was to identify a potential gene
expression
signature in peripheral blood that may allow development of noninvasive
screening tests to identify individuals at risk for TAA disease. Gene
expression profiles of
peripheral blood samples collected from 58 individuals diagnosed with
TAA and
36 normal individuals (controls) were analyzed using the Applied
Biosystems
Expression Array Systems and Human Genome Survey Microarrays. SAM
(Significance
Analysis of Microarray) analysis of 29,098 RNAs identified 1199
candidate
signature genes (markedly up- or down-regulated) characterizing the TAA
disease. Gene classification and biological pathway analyses of these
signature
genes revealed potential molecular mechanisms underlying this disease.
Signature genes were also determined to delineate ascending TAA vs.
descending
TAA, as well as TAA with or without family history. Additionally,
41-gene prediction
models for risk assessment of TAA were built for all-gender and male or
female,
respectively, using a training set containing 36 TAA patients and 25
controls.
10-fold cross-validation on these prediction models yield 82%, 90%, and
97%
overall accuracy for each model, respectively. When these prediction
models
were applied on an independent testing sample set containing 22 TAA
patients
and 11 controls, the overall prediction accuracies for all-gender, male
and
female models were 79%, 70% and 77%, respectively. This study
provides a comprehensive
gene expression profile of peripheral blood cells from thoracic aortic
aneurysm
patients and normal individuals. The biological pathways associated
with the
signature genes of TAA and its subtypes may provides further insights
into the
molecular pathogenetic mechanisms attributed to the pathogenesis of
this
disease. Our results also demonstrated a distinct RNA “signature” of
aneurysm
disease, setting the stage for a blood-based gene expression test may
to
facilitate risk assessment and early detection of thoracic aortic
aneurysm
disease. Session:
High
throughput quantitative PCR
Poster
number P 066 – P
076 Location:
Student Cafeteria P
066 Expression
profiling of receptor-like cytoplasmic
protein kinases (class VI) of Arabidopsis. Manuela Elena
Jurca, Attila Feher Email:
elenaj2006@yahoo.com Understanding
the mechanisms by
which plant perceive environmental signals in order to activate
adaptive
responses is of fundamental importance to biology. Receptor-like
cytoplasmic
protein kinases (RLCKs) are plant specific proteins encoded by more
then 150
different genes in the Arabidopsis genome. Despite of their high
number, the
available information on the potential function of RLCKs is very
limited. In
this report, the analysis of the gene expression pattern of 14 members
of one
of the RLCK families (RLCK class VI) is described. The technique of
real-time
quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR)
was used
to determine the transcript levels in Arabidopsis seedlings under a
series of
abiotic stress/hormone treatments as well as in different organs.
Quantitative
gene expression data was normalized for the expression of GAPDH-2 and
actin
(Act2/Act8) genes. In order to help the interpretation of the results,
a stress
responsive marker gene, RD29A, was also determined. Based on the
expression
data it can be concluded that the biological functions of RLCK
proteins,
despite their structural similarity, might be highly divergent and is
regulated, at least partly, at the transcriptional level. P
067 LightCycler®
480 Real-Time PCR System: Innovative
Solutions for High Throughput PCR. O. Geulen, G. Tellmann Roche
Diagnostics, Roche Applied Email:
Oliver.Geulen@Roche.com The
LightCycler®
Real-Time PCR Systems from Roche Applied Science have set standards for
maximum
flexibility, high speed and outstanding data accuracy. The latest
innovation,
the LightCycler® 480 Real-Time PCR System, continues
this tradition
and extends it to higher throughputs (96-well / 384-well format) by
using
plate-based analysis format. The modern instrument design, outstanding
technical and software features, as well as advanced reagents and
disposables
of the LightCycler® System pave the way for
high-performance
real-time PCR analysis. The LightCycler® 480 software
provides
versatile solutions for the most common real-time PCR applications like
gene
detection, gene expression and genotyping analysis. The system’s basic
software
package comprises basic software and application-specific modules which
provide
diverse methods for innovative analysis workflows. Furthermore, the
system now
offers a new analysis tool for high-resolution melting curve analysis
(HRM),
providing an innovative method to scan genes for unknown variations. P
068 Mutation
Scanning Using the LightCycler® 480 System. C.
Weilke, J.
Hurlebaus, L.
Gretschel, C. Roessler Roche
Diagnostics, Roche Applied Email:
Christian.Weilke@Roche.com Established
methods for PCR
genotyping using dye-labeled probes only allow for the detection of an
expected
sequence variation forming a mismatch to the probe sequence. For
screening for
any mutation in longer sequence intervals, sequencing is state of the
art.
However, sequencing is still expensive and not suited for
high-throughput
analysis. Here, we
describe a method that
enables scanning of genes for sequence variations by high-resolution
melting analysis of
amplicons. The equipment required comprises of a real-time PCR
instrument
enabling high resolution melting curve analysis like the LightCycler®
480 Instrument, a pair of target-specific PCR primers, PCR reagents
containing
a special fluorescent dye for detection, and an adequate evaluation
software. After PCR,
the amplicons from
several samples (gene sections of up to 600 bp) are analyzed by
high-resolution
melting. For amplicons with sequence variations, the melting curves
differ in
shape, especially when heterozygote DNA has formed heteroduplices. The
new
software module analyzes these small differences and groups samples of
similar
curve shape. Using samples of known sequence as standards, other
samples in the
same group can be assigned to this sequence. The new
method enables detection of
any sequence variation in the amplified DNA section. It is relatively
cheap,
requires little optimization (only a specific primer pair for
amplification
using the universal PCR master), and facilitates high-throughput
screening of
samples in 96- or 384-well plate formats. Therefore,
the LightCycler®
480 System is extended by a PCR reagent kit containing a new
fluorescent dye
that is optimized for this application, and a software module for
high-resolution melting curve analysis. P
069 New
concepts for accelerated real-time PCR analysis. Thorsten
Traeger1, Kirsten
Hildebrand1, Dirk Loeffert1, Ralf Peist1,
Annette Tietze1, Andrea Stutte-Rabe1, Ulla Deutsch1,
Dile Holton2, and Andreas Missel1 1QIAGEN GmbH, Email:
thorsten.traeger@qiagen.com Protocols for
fast PCR provide an
effective means of increasing assay throughput and significantly
reducing the
time required to go from nucleic acid template to final result.
However, fast
PCR using standard PCR chemistries has until now suffered from reduced
sensitivity as well as increased variability. We will focus on how to
overcome
the challenges of achieving fast PCR, both in real-time PCR and RT-PCR
analyses
and in end-point PCR applications. Issues that will be discussed
include: • The use of
optimal combinations of
cations and additives in the PCR buffer to provide specific and
accelerated
annealing of primers and probes to nucleic acid templates. • The use of
a recently developed
hot-start DNA polymerase and inhibition-relieving agents to improve
fast
end-point PCR assays and fast real-time RT-PCR assays (both one-step
and
two-step) which previously exhibited poor sensitivity and specificity. Data showing
successful real-time
and end-point PCR analyses with time savings of up to 70% will be
presented.
The real-time PCR data will include data generated using different
detection
formats, such as SYBR Green dye and sequence specific probes. P
070 On-Chip
Polymerase Chain Reaction with integrated Real-Time
Detection. J. Felbel1,
A.
Reichert1, S. Julich1, M. Kielpinski1,
M.
Urban1, 1Institute for
Physical High
Technology, Albert-Einstein-Str. 9., D-07745 Jena, Germany, 2Clinic
for Obstetrics and Gynecology, Friedrich-Schiller-University Jena,
Bachstr. 18,
D-07740 Jena, Germany and 3Analytik Jena AG,
Konrad-Zuse-Str. 1, D-07745 Email:
anett.reichert@ipht-jena.de The
mechanistic simplicity of the
PCR process made it an ideal candidate for automation and
miniaturization. The
advantages of miniaturized PCR-chip devices over conventional
thermocyclers are
low power consumption, fast total analysis time, and reduced amount of
sample
and reagents. During the development of micro chip thermocyclers for
on-chip
PCR several strategies have been followed. Of particular importance
thereby
have been the stationary and continuous flow PCR chips [1]. The
fabrication of
PCR micro chips is based on the micro system technology for its ability
to
produce small structures. Importantly, the micro fabrication technique
also
provides a possibility for integrating various functional components on
the
same chip. The aim of PCR on-chip developments at our institute (IPHT)
is the
integration of fluidic and thermal management with optical readout for
real-time detection [2]. An important point of real-time detection is
the
specific detection and the possibility for quantification of PCR
products
on-chip. We will show the detection system and the results of real-time
detection
on the developed stationary working 2D PCR chip. We used Sybr-Green and
double-labeled fluorescent TaqMan Probes (FAM/TAMRA) to detected the
fluorescent signals. So it was possible to reach a limit of detection
of
on-chip PCR by 10 DNA molecules in a sample volume of 1 µl. The vision of
another special
research project is the establishment of a system to detect single
disseminated
tumour cells in the blood of patients with cervical carcinoma. A
special
characteristic of these cells is the expression of oncogenes encoded by
Human
Papilloma Viruses (HPV), which can be specifically amplified by in-situ
RT-PCR
[3]. Therefore, we have developed a micro chip reactor for application
of
flow-through in-situ RT-PCR in tumor diagnostics. One step of
device development
is the transfer of the real-time detection system from the stationary
chip to
the flow-through PCR chip. The general suitability of the chip system
was
proven by RT-PCR of RNA, isolated from cells, expressing the HPV 16
target
oncogene and will be present P
071 Optimisation
of a Real Time RT-PCR protocol for the
analysis of gene expression in hop tissues. Lina Maloukh 1,2,
Jelle De Keukeleire 1,2, Erik Van Bockstaele 1,2
, Isabel
Roldán-Ruiz 1 1Institute for
Agricultural and
Fisheries Research, Unit Plant, Applied Genetics and Breeding,
Caritasstraat
21, 9090 Melle, Belgium and 2Ghent University, Faculty of
Bioscience
Engineering, Department of Plant Production, Coupure Links 653, 9000
Ghent,
Belgium Email:
Lina.Maloukh@ilvo.vlaanderen.be Hop (Humulus
lupulus L.) is a
dioecious, perennial, climbing plant, included in the family
Cannabaceae.
Female hop plants are cultivated in most temperate regions of the
World, for
the extraction of secondary metabolites. Important secondary
metabolites
produced by hop include α-acids and β-acids and essential oils, which
are used
in beer brewing, as well as the prenylated chalcones, Xanthohumol, and
Desmethylxanthohumol, which exhibit interesting bioactive properties.
All these
compounds are synthesized in relatively high amounts during the
development of
the female inflorescences of hop into cones and are accumulated in the
lupulin
glands. The most prominent hop prenylflavonoids are the prenylchalcones
Xanthohumol and Desmethylxanthohumol.These prenylchalcones can be
readily converted
to isomeric prenylflavanones, whereby Xanthohumol gives rise to
Isoxanthohumol
and Desmethylxanthohumol renders a mixture of 8-prenylnaringenin and
6-prenylnaringenin. Xanthohumol displays a broad spectrum of inhibition
mechanisms at the initiation, promotion and progression stages of
carcinogenesis. 8-prenylnaringenin, which results from isomerization of
Desmethylxanthohumol in the brew kettle, is the most potent
phytoestrogen known
to date. It is, therefore, of great interest to identify and
characterize the
genes that regulate the formation of Xanthohumol and
Desmethylxanthohumol in
female hop plants. In a previous study (De Keukeleire et al. submitted)
we used
the differential screening technique cDNA-AFLP to identify candidate
genes
involved in the biosynthetic pathway of prenylflavonoids in hop.
However, up to
now, only semi-quantitative expression profiles are available for these
candidate genes. Therefore, a detailed expression analysis of the
candidate
genes in different hop tissues and at different developmental stages
using
Real-Time RT-PCR is essential to demonstrate the possible implication
in these
genes in the biosynthetic pathway of prenylchalcones in hop. Our
Objective in
this study was to develop a test for the analysis of the expression
profiles of
previously identified candidate genes in hop tissues. Here we report on
the
selection of suitable housekeeping genes and on the expression levels
of a
putative transcription factor HEN1 homologue in different hop tissues
from
several genotypes, using Real Time RT-PCR. P
072 Q-PCR
analysis of the effect of hepatocyte growth
factor on Doxorubicin induced cell death. Salehi M., Keyhanian K.,
Salehi R. Dept. of
Genetics and Molecular
Biology, Medical School, Isfahan University of Mdical Sciences,
Isfahan, Iran Email:
m_salehi@med.mui.ac.ir Hepatocyte
Growth Factor (HGF/SF)
has opposite biological activities in regulating apoptosis, also
molecular
mechanisms involved in these processes are not clearly defined. We
investigated
HGF ability to protect cell death which was induced by a DNA damaging
agent
(Doxorubicin). Also Survivin and XIAP mRNA levels were compared in HGF
treated
and not-treated cells. Cell
proliferation and death were
assessed using MTT assay and dye exclusion tests. Quantitative
real-time PCR
was used to evaluate Survivin and XIAP expression levels after
treatment with
HGF. ELISA was performed to quantify HGF secretion in selected cancer
cell
lines media. HGF appeared
to have inhibitory
effect on Doxorubicin induced cell death in all cell lines we tested.
It had
minimal effect on XAIP and Survivin expression levels in MRC-5, MOLT-4
and AGS
cell lines; except for XIAP expression level in AGS cell line which was
increased substantially after treatment. Surprisingly, in KG-1 cell
line, XIAP
and Survivin expression levels were significantly reduced after HGF
treatment. Although
several members of IAP gene
family are reported to play role in HGF induced antiapoptotic pathway,
we
showed that XIAP and Survivin do not seem to be involved. P
073 qPCR
Arrays-based gene profiling of Tie2-expressing
monocytes (TEMs): contamination analysis by qPCR and multiple linear
regression
analysis of data. Pucci F. 1,2,4
Venneri MA. 1,2
Moi D. 1,2 Di Serio C. 3,4 Naldini L. 1,2,4
De
Palma M. 1,2 (1) San Raffaele
Telethon Institute for Gene Therapy
(HSR-TIGET), Via Olgettina 58, 20132, Milan, Italy; (2) Angiogenesis
and tumour
targeting research unit (ATTRU), Via Olgettina 58, 20132, Milan, Italy;
(3)
University Centre for Statistics in the Biomedical Sciences (CUSSB),
Università
Vita-Salute San Raffaele, Via Olgettina 58, 20132 Milan, Italy; (4)
Università
Vita-Salute San Raffaele, Via Olgettina 58, 20132 Milan, Italy Email:
ferdinando.pucci@hsr.it Tumours are
made not only of
neoplastic cells, but also of different types of stromal cells, which
play both
anti- and pro-tumour activities during cancer progression. The concept
that
haematopoietic cells – myeloid-lineage cells in particular – are more
likely to
promote tumour growth than to mount effective anti-tumour responses has
received broad recognition. However, little is known of the molecular
mechanisms responsible for the pro-tumour activities of myeloid cells.
We
recently described a population of bone marrow-derived monocytes that
express
Tie2, the angiopoietin receptor previously known to be specifically
expressed
by endothelial cells (ECs). TEMs specifically home to tumours and other
angiogenic sites and are required for tumour angiogenesis and growth,
but are
distinct from endothelial progenitor cells since they do not
incorporate into
growing vessels. The precise identity and the molecular bases of the
pro-angiogenic activity of TEMs still need to be elucidated. In this study
we compared the gene
expression profile of TEMs with that of other myeloid cells, isolated
from both
tumours and non-neoplastic tissues of Tie2-GFP reporter transgenic
mice, by
TaqMan Low Density Arrays. These devices are 384-wells custom cards
configured
as 93+3 target/housekeeping genes in quadruplicate. Since both TEMs and
ECs
share phenotypical features and express GFP in our model, the potential
ECs
contamination of flow-sorted TEMs represents an important technical
issue. We
used qPCR to quantify ECs contamination by assessing the expression of
5
ECs-specific genes. We then designed 3 arrays containing about 300
genes among
cytokines and growth factors, receptors, proteases, guidance and
adhesion
molecules, immunity-related genes and transcription factors. Data
obtained from
2 biological replicates (each made by cells harvested from 10-15 mice)
were
analysed with a multiple linear regression model to identify
differentially
expressed genes. We were able
to virtually abolish
ECs contamination by inlcuding a negative selection to exclude ECs
during TEMs
isolation. Our results indicate that TEMs are a defined population of
tumour-infiltrating myeloid cells, since 33% of the interrogated genes
were
differentially expressed in TEMs versus GFP-neg tumour macrophages
(p<0.05).
Greater differences in gene expression were found between TEMs and
peritoneal
macrophages and between TEMs and CD11b+Gr1+ myeloid-derived suppressor
cells.
Some of the differentially expressed genes may have a critical role in
angiogenesis and tissue remodelling; moreover, TEMs express a unique
set of immuno-modulator
molecules, suggesting that TEMs may also create an immune-privileged
environment that promotes tumour growth and ECs survival. These studies
will be extended to a
genome-wide profile on human TEMs. These results will help elucidating
the
biology of TEMs in mice by focusing on the relevant targets and will
potentially identify novel targets of anticancer drugs. P
074 Transcriptional
profiling of the ABC transporters
family using Taqman Low Density Array. Edith
GARRIDO, Jean-Yves LALLEMAND
and Eric JACQUET. ICSN - CNRS, Email:
Eric.Jacquet@icsn.cnrs-gif.fr The
ATP-binding cassette (ABC)
transporters, a large family of transmembrane proteins, have essential
physiological and protective functions in cells. ABC transporters are
encoded
by 49 identified genes in human and have been classified in seven
subfamilies
(A to G). Mutations in genes encoding these proteins are related to
diverse
genetic diseases in human. Most of these ABC proteins are involved in
transport
of a large variety of substrates (amino acids, lipids, ions, sugars,
drugs...)
across cellular membranes. Some ABC transporters have essential
functions such
as excreting liver or kidney toxins, or limiting penetration of toxic
molecules
in vital organs, such as brain or placenta. Multidrug resistance of
cells is
also correlated with the overexpression of several ABC transporters
that induce
drug-resistance phenotypes of tumor cells to anti-cancer chemotherapies. To carry out
ABC expression studies,
we have developed high throughput quantitative PCR using TaqMan probes
and ABI
7900HT QPCR instrument with fully automated robotic loading. We have
designed
microfluidic cards (TLDA, TaqMan Low Density Array, applied Biosystems)
that
allow quantifying simultaneously the expression of all these ABC genes
in human
or in mouse. These TLDA also contain 10-15 housekeeping genes for data
normalizations. QPCR efficiency of the probes was first controlled
using
samples standard curves, plasmid dilutions and linear regression
calculations
(LinRegPCR). Housekeeping genes were selected with GeNorm and
NormFinder
software. Normalization was provided using the geometric mean of 3-5
selected
genes. Results were expressed with the relative quantification using
2-ddCt
method. Moreover, in the cell lines studies, the copy numbers of mRNA
per cells
were estimated to have a better overview of the ABC expression pattern. This
technique allow us to get an
overall picture of the expression level of the ABC transporters, in
various
organs, tissues and cell lines from human and mouse. We analyzed the
ABC
expression pattern of different cell lines commonly used for
cytotoxicity
assays. We compared these expression levels to their resistant sublines
and we
correlated ABC profiles with the chemoresistance phenotypes. We have
also
mapped the expression of ABC transporters in different mouse organs and
used
this in-vivo model to measure their variations in response to a
cytotoxic
injection. Finally, we have studied the ABC profiles 1) in human liver
at different
stages of development (foetal, new-born, adult) and 2) in biopsies of
patients
with acute leukemia in correlation with their sensitivity towards
chemotherapies. To date,
several ABC transporters do
not have any known substrate and physiological function yet. Therefore,
studying expression of this gene family may help to explain their
potential
role in human diseases and anti-cancer therapies. P
075 BioMark™
Dynamic Arrays and Digital Arrays for Gene
Expression Quantification and Absolute Quantification of mRNA in Human
Saliva
Samples. Pieprzyk
Martin, Yaccato
Karin, Herren Michael Fluidigm
Corp., Email:
marc.unger@fluidigm.com Human saliva
samples hold great
promise for a simple and direct method to obtain gene expression
profiles and
detect cancer biomarkers. Messenger RNA sequences from human saliva
samples
were quantified extremely accurately using digital PCR. The BioMark
Dynamic
Array performs qPCR on 48 genes against up to 48 samples. The dynamic
array was
used to profile gene expression on a panel of 48 genes for each sample. P
076 Use
of standardized mixtures of internal standards in
automated high throughput quantitative PCR to generate
quality-controlled
transcript abundance measurements that are reproducible across
institutions. Gene Express
Inc., 975 Research Drive
Toledo, Ohio, USA, University of Toledo Health Sciences Campus Toledo,
Ohio,
USA Email:
ehpeters@geneexpressinc.com Profiling
mRNA transcript abundance
(TA) of multiple genes in whole blood or biopsy samples vastly
increases the
potential for phenotypic characterization over that obtainable by
morphological
analyses. It is widely anticipated that a TA measurement method that
generates
data suitable for regulatory review will facilitate development of new
drugs
and improved diagnostic tests. Standardized RT-PCR (StaRT-PCRTM)
has
the performance characteristics recommended by the FDA to generate such
data.
These performance characteristics are achieved by measuring each gene
relative
to a known quantity of its respective internal standard formulated
within a
Standardized Mixture of Internals Standards (SMISTM). In
order to
determine the inter-site precision of TA measurements, fifteen genes
were
analyzed over more than a two year period in multiple reverse
transcribed cDNA
samples from the same lot of Stratagene Universal Human Reference RNATM
at the Standardized Expression Measurement (SEMTM) Center
established at the University of Toledo (UT: Toledo, OH) and two newly
established SEM Centers located at Gene Express (GX: Toledo, OH) and
Gene Logic
(GL: Gaithersburg, MD). Potential sources of analytical variation
included
variation across different commercial liquid handlers (Packard and
Hamilton),
two thermocyclers (MWG and Biorad), two Caliper devices (AMS 90 SE30
and LC90
models) with multiple chips, and cDNA samples from two different
aliquots of
the same lot of RNA sample across three different sites. The measured
genes
spanned an expression range from 37 GPT transcript molecules/10^6 ACTB
transcript molecules to 99,000 MYC transcript molecules/10^6 ACTB
transcript
molecules. When the average data from GX, GL and UT were compared, for
each
gene the range of TA measurements was less than two-fold with CVs
ranging from
10.9% to 29.6%. SLC15A2 and GPT had larger CVs in part due to
stochastic
sampling variation associated with low numbers of molecules (fewer than
100
molecules) in each assay. Variability was higher across sites (e.g. UT
vs. GL)
than within sites. This study demonstrates that use of SMIS reagents
and
StaRT-PCR technology generates TA data that may be directly compared at
different sites over time. This will enable generation of a
standardized,
numerical database, which is essential for wide-scale implementation of
PCR in
molecular diagnostic tests and drug development. Session:
qPCR NOS
Session
Normalization
& Optimization & Standardization Poster
number P 077 – P
104 Location:
Student Cafeteria P
077 Christensen
U.B., Nielsen C.
& Skadhauge K. Email:
ubc@pentabase.com The invention
of real time PCR has
revolutionized the way of determining the expression status of a gene,
in a
fast and precise manner. Detection and quantification of the target can
be done
by using different technologies, among others molecular probes. One of
the
major challenges for the molecular probes is to be able to discriminate
between
very similar target varying in as little as one nucleotide, e.g
detection
methylation status of single CpG duplets and SNP detection. The
EasyBeacons™ presented here are
based on the novel technology of Intercalating Nucleic Acid, INA®,
linked to a fluorophore and a quencher. INA® is composed
of normal
DNA nucleotides and Intercalating Pseudo Nucleotides (IPNs). The fact
that the
EasyBeacons™ are mostly composed of normal DNA nucleotides means, that
in many
respects the EasyBeacons™ behave like DNA based probes, allowing the
use of
standard buffers, primers and enzymes and hence reduces the
optimisation
efforts. The IPNs of
the EasyBeacons™
comprise hydrophobic moeities that will bring the fluorophore and the
quencher
of unbound probe in close proximity of each other. The quenching of the
flourescense, and the improved signal-to-noise ratio are therefor not
dependent
on the sequence of the DNA nucleotides. Due to the high affinity of INA®
towards complementary DNA, the EasyBeacons™ can be made shorter and
hence more
specific than their DNA counterparts. The non
temperature dependent
quenching EasyBeacons™ is also very suitable for multiplex PCR , and
compatible
with most, if not all the commercially available real time PCR
instruments. The results
presented here show the
use of EasyBeacons™, generating a better signal-to-noise ratio, a
higher
affinity and specificity in detection of the methylation status of
single CpG
duplets and SNPs. Furthermore,
taking advantage of the
possibility to include an end point verification measurement, since the
EasyBeacons™ are not degraded during PCR amplification, is proven to be
valuable. The ease of
design and optimization
of the real time PCR assays using the EasyBeacons™ is also discussed. P
078 Karl Schedle1, Michael W.
Pfaffl2 and Wilhelm Windisch1 1Division of
Animal Food and
Nutrition, Department of Food Science and Technology, University of
Natural
Resources and Applied Life Sciences, Austria and 2Institute
of
Physiology, TUM Weihenstephan, Germany Email:
karl.schedle@boku.ac.at In the
present study we investigated
the effect of two fiber sources differing in microbial degradability on
expression rate of the anti- and pro-inflammatory marker genes TGF β
and TNF α,
respectively, the transcription factor NFkB in the gastrointestinal
tract (GIT)
of weaning piglets. The study employed a total of 36 weanling piglets
fed ad
libitum. Two diets were modified by adding wheat bran or pollen from
Chinese
Masson pine (pinus massoniana) and compared to a control group. The
amounts of
added fiber sources were adjusted to result in equal contents of total
dietary
fiber. Animals were distributed according to litter, sex and initial
body
weight among the 3 types of diet. Tissue samples of the (GIT) were
collected
and stored at -80 °C. Total RNA of samples was isolated using
TriFast. qPCR was
carried out as two-step PCR. Relative quantification of cDNA
(respectively,
mRNA) was carried out with the Eppendorf realplex Cycler. The crossing
points
were acquired with the delta-Ct-method using the mean expression of two
reference genes (histone H3 and beta-actin). Relative quantification
was
calculated by the delta-delta-Ct method, compared to the untreated
control
group. Gene expression rate of the pro-inflammatory marker Gene TNF α
did not
differ between fiber sources in the gut. In mesenterial lymph nodes,
however,
TNF α was up-regulated by wheat bran (n.s) and by pine pollen
(p<0.1).
Regarding the anti-inflammatory marker gene TGF β, wheat bran resulted
an
up-regulation in the stomach (p<0.05) and jejunum (p<0.05), while
in the
ileum and colon gene expression did not differ from control (n.s.).
Pine pollen
addition resulted in numerical up-regulation in stomach and jejunum
(n.s.)
while in ileum and colon the reactions were of minor extent. In
mesenterial
lymph nodes, however, expression of TGF β was numerically up-regulated
by pine
pollen (n.s.) while no effect was visible, with wheat bran. Only in the
stomach, NFkB was numerically up-regulated by wheat bran and pollen
(n.s.). The
results indicate the ability of fiber sources to affect the expression
of
inflammatory marker genes TGF β and TNF α. The simultaneous
up-regulation of
both pro- and anti-inflammatory marker genes in mesenterial lymph nodes
e.g. in
case of the pine pollen group seem to reflect a general stimulation of
activity
of the immune system through additional dietary fiber intake. This
hypothesis
is supported by the absence of reaction of the pro-inflammatory marker
gene TNF
α in the small and large intestine. This hypothesis is furthermore
confirmed by
the absence of up-regulation from NFkB, a transcription factor for TNF
α and
the simultaneous up-regulation of anti-inflammatory marker gene TGF β
in other
gastrointestinal tissues. The up-regulation of TGF β in the stomach and
jejunum
may therefore be interpreted as indicator of increased cell
proliferation. P
079 Barbara Rocca, Silvia
Calatroni, Ilaria Giardini,
Marina Boni, Irene Dambruoso, Paolo Bernasconi Division of
Hematology, IRCCS
Policlinico S. Matteo Foundation, Email:
s.calatroni@smatteo.pv.it Real-time
polymerase chain reaction
(PCR) methodology is now broadly used to quantitate target sequences
for
diagnostic purposes. Despite the growing availability of commercial in
vitro
diagnostic assay, “home-made” real-time PCR methods, using commercial
reagent
master-mix are still applied in many laboratories. Aim of the present
study was
to analyse the effect of different SybrGreen master-mix manufacturing
lots and
suppliers on real-time PCR parameters. The analysis was conducted on a
well-assessed “home-made” relative quantification BCR-ABL assay, using
ABL as
normalising gene and five log dilution of leukemic cell line K562 cDNA.
To
minimize variability due to reverse-transcription (RT), all the cDNA
was
obtained through the same RT reaction using random hexamers primers and
SuperScript II (Invitrogen). We compared four different manufacturing
lots of a
same product (same p/o number), provided by a single supplier (Applied
Biosystems) and six different suppliers of SybrGreen master-mix, with
Rox
(Applied Biosystems, Bio-Rad, Eurogentec, Finzyme, Qiagen and
Stratagene). All
the reaction were conducted in duplicates on a GeneAmp5700 (Applied
Biosystems), using the same production lot of primers and the same
thermal
conditions. As expected, differences in PCR parameters has been, in
some cases,
observed in master-mixes of different suppliers, due to differences in
reagents
composition. Interestingly, differences in Tm values (max
deltaTm=1.5°C), Ct
values (for each dilution point deltaCt range between 0.01 and 1.45 for
BCR-ABL
, and between 0.06 and 2.07 for ABL), max deltaRn at the last PCR cycle
and
reaction efficiency have been also evidenced when comparing different
lots of
the same product; efficiency variations were not always comparable in
the
BCR-ABL and ABL assays. In conclusion, if master-mix composition is
surely
important during assay optimisation, particular care has to be taken
introducing different lots of a same commercial master-mix, especially
in
diagnostic assay, and validation of the new preparation lot should be
advisable. P
080 SZASZ AM1, TOKES AM1,
SZABO E1, NEMETH ZS1, JAKAB CS1,
MOLNAR IA2,
FARKAS A1, MADARAS L1, KISS A1, KULKA J1 12nd Dept. of
Pathology and 21st
Dept. of Surgery, Email:
cac@korb2.sote.hu INTRODUCTION Members of the claudin gene family are
differently expressed in healthy tissues and various types of tumours.
According to the literature the investigation of claudin patterns lead
to
unequivocal results. Therefore, we examined the expression of 9 claudin
types
in invasive ductal breast carcinomas and their normal adjacent tissue
(NAT). METHODS A total of 23 breast samples (8 invasive
ductal carcinomas, their 8 NATs, 3 lobular carcinomas, and 4 NATs) have
been
analysed for their claudin pattern with real-time PCR and
immunohistochemical
method. Sybr Green
real-time PCR method was
used for detection of claudin-1, -2, -3, -4, -5, -7, -8, -10 and -12. A
melting
peak profile was produced after each amplification. The PCR data were
analysed
with both the Relative Expression Software Tool XL Version 2 (REST-XL)
and the
latest version of REST-384 using pair wise fixed reallocation
randomisation
test. Immunohistochemical
detection
(streptavidin-peroxidase procedure) of claudin-1, -2, -3, -4, -5 and -7
was
performed on formalin-fixed, paraffin-embedded sections on a set of 20
invasive
ductal breast carcinomas. RESULTS The mRNA expression of claudin-1, -2, -3, -4,
-5, -8 and -10 were found to be down-regulated in all tumours, while
claudin-7
and -12 were up-regulated in carcinomas compared to their NATs.
Statistically
significant alteration of claudin-12 was observed in the ductal type of
invasive carcinoma group only (with a p value of 0,001). Immunohistochemistry
revealed the
expression of claudin-1 as being markedly decreased in tumours compared
to
NATs. Immunohistochemically, there were no significant differences in
claudin-2, -3, -4 and -7 expression in the majority of invasive ductal
breast
carcinomas as compared to NATs, in concordance with the real-time PCR
data.
Claudin-5 was not only observed in tumour cells, but in endothelial
cells as
well. Claudin -8, -10 and -12 immunohistochemistry is being adjusted. CONCLUSION According to our observations, the expression
of claudin-1, -7 and -12 seem to be different in tumours compared to
normal
breast tissue, as demonstrated by real-time PCR and
immunohistochemistry. This
finding may suggest their possible role in carcinogenesis. The
significantly
higher expression level of claudin-12 requires further investigation. P
081 Kliem
H., Schams
D., Berisha B. Physiology,
TUM, Email:
heike.kliem@wzw.tum.de The rupture
of a follicle during
ovulation has been thought to be an inflammatory like process with the
induction of pro-inflammatory cytokines and invasion of immune cells.
The aim
of this study was to evaluate the expression pattern of tumor necrosis
factor alpha
(TNFalpha), its two receptors (TNFalpha-R1, TNFalpha-R2), interferone
gamma
(INFgamma), interleukine-1 beta (IL-1beta), monocyte chemoattractant
protein-1
(MCP-1), its receptor CCR-2, eotaxin-3 and its receptor CCR-3 in
time-defined
follicle classes before and after GnRH application and after ovulation
in the
cow. Ovaries containing preovulatory follicles or new corpora lutea
(CL) were
collected at approximately 0, 4, 10, 20 and 25h (follicles) and 60h
(new CL)
relative to injection of GnRH to induce an LH surge (n = 5 animals per
group).
The mRNA expression was evaluated by a two step real time PCR
(Rotor-Gene 3000)
and the data were normalised with the mean value of the three
housekeeping
genes ubiquitin, GAPDH and histone. TNFalpha, its two receptors and
INFgamma
showed no regulation, whereas IL-1beta revealed an up-regulation at 25h
(around
ovulation) and 60h (new CL). The expression of MCP-1 was increased
during the
LH surge (4h) and further on around ovulation (25h) and in the new CL
(60h).
Its receptor CCR-2 was down-regulated 10h after GnRH application and
increased
again till its maximum expression at 60h. In contrast to MCP-1 showed
eotaxin-3
its highest expression at 0h and 4h (LH surge) followed by a decrease
at 20h
and 25h (around ovulation) after GnRH injection. Its receptor CCR-3 was
decreased around ovulation (25h) and increased in the new CL (60h).
These data
suggest that during ovulation only IL-1beta and MCP-1 seem to play an
important
role. The increased expression of eotaxin-3 during the LH surge could
trigger
the invasion of eosinophils into the ovulating follicle, which might be
necessary for an optimal angiogenesis in the developing CL. P
082 External
cell control quantitative RT-PCR (eccPCR): a
new technique for reliable detection of subtle changes in mRNA
expression. Polett
Ribiczey 1,
András Bors1, Gabriella Köblös2,
Anna Brózik 1,
Zsuzsanna Ujfaludi 3, Mária Magócsi 1,
András Váradi 2,
Attila Tordai 1, Tünde Kovács 1,
Tamás Arányi 2 1National
Medical Centre, Institute
of Haematology and Immunology, Budapest, Hungary, 2Institute
of
Enzymology, Hungarian Academy of Sciences, Budapest, Hungary and 3University
of Szeged, Faculty of Sciences, Department of Biochemistry and
Molecular
Biology, Szeged, Hungary Email:
ribiczey@kkk.org.hu Quantitative
RT-PCR (qRT-PCR) is a
widely used method to determine relative gene expression levels.
Quantification
of the observed expression levels becomes reliable after normalization
to the
expression of an internal standard gene. However, the expression of
commonly
used internal standard genes is often unstable, which considerably bias
quantification. To overcome the drawback of unstable internal
standards, we
developed a new method, called external cell control PCR (eccPCR). This
method
is based on the addition of control cells to the studied cells before
RNA
extraction and qRT-PCR. Only the control cells express the reference
gene,
while only the studied cells express the gene of interest. Here we
present the
validation of the method in various model systems including both
adherent and
non-adherent studied cells and either mammalian or Drosophila control
cells. We
demonstrate that in contrast to the use of common internal standard
genes the
eccPCR technique allows accurate quantification of small expression
level
differences of the genes of interest. P
083 External
standard curve for absolute quantification of
genomic DNA sequences by Real Time PCR. Raffaele Di
Francia1, Ferdinando
Frigeri1, Rosaria De Filippi1,2, Giancarla
Iaccarino1,
Gennaro Varriale3, Antonio Arbitrio3 and Antonio
Pinto1 1Hematology-Oncology
Unit, Istituto
Nazionale Tumori, Fondazione "G. Pascale", IRCCS, Naples, Italy, 2Dipartimento
di Biologia e Patologia Cellulare e Molecolare, Università degli
Studi
'Federico II', Naples, Italy and 3Senebgene s.r.l., Naples,
Italy Email:
rdifrancia@libero.it Background. Real-Time PCR
is the method of choice for
quantification of a given DNA target. Determination of the relative
abundance
of a DNA sequence is usually accepted as a reliable tool to measure
differences
among samples. However, absolute determination of the number of copies
for a
DNA target can result of a greater value for minimal residual disease
(MRD)
evaluation in hemopoietic neoplasms. Methods. We
describe a simple method
to build an external standard curve by means of a recombinant plasmid
DNA,
exactly quantified by competitive PCR against a specific competitor,
i.e. a
non-human DNA fragment of known concentration. Such approach was
developed to
quantify two genetic marker breakpoints of non-Hodgkin’s Lymphomas,
i.e. the
t(14;18) and t(11;14), respectively associated to Follicular (FCL) and
Mantle
Cell (MCL) lymphomas. Quantitative-PCR (Q-PCR) assay was performed by
two
different methods: i) TaqMan chemistry for t(14;18) and ii) SYBR Green
for
t(11;14). Standard stocks were constructed by diluting 900000.0 copies
of
translocation-specific plasmids with 500 ng of DNA from a pool of
healthy
donors. Standard stocks were further serially diluted (900000.0-9.0) to
build
external standard curves for each of the targets, i.e. FCL curve (pFCL)
and MCL
curve (pMCL). Copy numbers of t(14;18) or t(11;14) were normalized by
concurrently quantifying copies of the internal reference gene albumin
for each
dilution point. Results. The
sensitivity of such
Q-PCR strategy, assessed by evaluating the rearranged gene copy numbers
on
positive sample curves, i.e. DNA from t(14;18)- and t(11;14)- positive
cell
lines serially diluted in 500 ng of healthy DNA, was of 8.5 rearranged
gene
copies/500 ng DNA (lower limit). Performance of standard curves was
evaluated
by collecting data from different (daily-prepared) curves (pFCL=24) and
(pMCL=10), utilized over 1 year. Analysis of coefficient of variation
(CV)
calculated on the slope values from daily standard curves, displayed a
high
intra-assay (CVs 1,7% for pFCL and 1,9% for pMCL) and inter-assay (CVs
7,7% for
pFCL and 5,9% for pMCL) reproducibility. As opposed to genomic DNA
curves, both
pFCL and pMCL showed a high stability even following long-term storage
(> 1
year). To improve reagent resistance against unspecific DNase cleavage,
we
compared the performance of linearized and non-linearized forms of both
pFCL
and pMCL. The means of Ct values for both forms of plasmids did not
show any
statistically significant difference (Fisher’s Exact Test). Upon
routine use in
the context of clinical trials, our methodology was able to efficiently
monitor
MRD with a detection limit as low as 10 tumor cells/100000 normal
cells.
Conclusions. The described system: i) can be used to build robust
standard
curves for absolute quantification of any DNA target of interest; ii)
displays
a high intra-/inter-assay sensitivity and reproducibility; iii) is
suitable for
use with any Q-PCR strategy (TaqMan; SYBR Green) P
084 A
Novel Thermostable DNA Polymerase for Real-Time
Quantitative PCR. Nery J., Andersen
M., Padmabandu G., Bishop
J., Lee J., Mi Q., Finn P., Meredith R. Email:
jonathan.nery@invitrogen.com Since the
invention of Polymerase
Chain Reaction (PCR), the technology has been routinely used in
research and
diagnostic laboratories across the world. The technology has seen many
advances
in reagent development where novel DNA polymerase formulations have
contributed
to the overall improved performance of quantitative PCR systems. The
development of hot-start mechanisms to inhibit polymerase activity at
reaction
set up temperatures has simplified the workflow for end users and also
improved
PCR performance by limiting PCR artifacts. Here we
present a novel hot-start
DNA polymerase formulation for use in quantitative PCR applications.
The
formulation is based on Thermus filiformis DNA polymerase, a
thermostable DNA polymerase developed to perform better than Taq DNA
polymerase. A novel antibody mediated hot-start mechanism is also
described. P
085 Comparison
of different real time PCR SYBR® Green kits. C Mazurier,
CHAPEL A., A Elselmi INSERM U832
Paris, EBI Cergy
PontoiseFrance Email:
a.elmselmi@ebi-edu.com Technical
advances in the field of molecular
biology, particularly for real-time PCR (RT-PCR), have greatly expanded
the
number of users, so that RT-PCR plays a crucial rule in numerous
studies. A
wide range of detection systems are available for RT-PCR, all based on
the
propagation of a fluorescent signal which is proportional to the
initial amount
of nucleic acid. Here we focus on the use of non-specific fluorescent
dye, SPBR
Green. SYBR green chemistry has proven to be the easiest and most
cost-effective method employed for RT-PCR. Many companies have
therefore
developed a wide range of ready-made kits in order to facilitate rapid
and
reproducible results. As these kits are all ostensibly based on the
basic
chemistry our goal was to compare 8 different kits (kindly provided by
ABgene,
Applied Biosystem, Eurogentech, Finnezyme, Invitrogen, Qiagen, Sigma
Takkara). in
order to check if these different mixes have impact on different
critical
points as RT - PCR efficiency, sensitivity, specificity. To do this,
eGFP gene
was amplified with the same primers set for all kits. No obvious
difference was
observed. P 086 Development
of an external standard for RT-qPCR. Françoise
WESSNER, Véronique MONNET INRA, Jouy en
Josas, France Email:
francoise.wessner@jouy.inra.fr The RT-qPCR
is a very sensitive
method but its reliability strongly depends on an appropriate
normalisation. In
order to avoid the bias caused by the fluctuation of an housekeeping
gene, and
because the use of several housekeeping genes (Vandesompele et al.,
2002) is
laborious and expensive, we have chosen to develop an external standard
added
to the RNAs before the retrotranscription step. The aim of
this study is the setting
up of an external standard and its validation for bacterial gene
expression
measurement by RT-qPCR. Our model concerns the expression of
oligopeptide
binding proteins encoding genes during growth in milk. The oligopeptide
transport system of Streptococcus thermophilus is fundamental
for its
optimal growth (Garault et al., 2002). It belongs to the ABC
transporters family
and is composed of 3 oligopeptide binding proteins (in our strain)
encoded by
the amiA1 _amiA2_ and amiA3 genes, 2 transmembrane
proteins
forming a channel and 2 ATPase providing energy to the system. Since
the
sequences of the amiA genes are very homologous, we increased
the qPCR
specificity with the TaqMan technology to bypass non specific
amplification. We choose a
mRNA encoding the
luciferase gene as external standard as it is absent in the lactic acid
bacteria strains and commercialised by Promega. Its use allows the
detection of
DNA polymerase inhibitors. The use of this tool requires a very precise
quantification of total RNA. We decided to do it with the Nanodrop
since there
is no need to dilute the sample. The quality of our RNA samples was
checked
with Agilent analysis ( Nano LabChip kit). We have shown
that the addition of
8.103 to 2.107 molecules of the luciferase
mRNA/µg total
ARN does not interfere with its own retrotranscription nor with the
retrotranscription of target genes. For the rest of the study we added
106
molecules per sample. The study of
the amiA genes
expression shows similar transcription profiles with an optimum
expression in
the middle of the exponential phase. The amiA3 gene is
significantly
more expressed than the amiA1 and amiA2 . These
results - and the
fact that the growth of a amiA3 mutant stop at an early stage
(data not
shown) - showed that this protein has a determinant role on bacterial
growth in
milk. It is important to note that we did not observe any variance in
RNA
quantity in our samples. We
demonstrated that RT-qPCR using
luciferase standard is effective for absolute quantification in
bacteria in
absence of suitable housekeeping genes. P
087 High-throughput
selection and validation of qPCR
reference genes for barley. Skov Jakob, Hagedorn
Peter, Lyngkjær Michael F. Biosystems
Department, Risø National
Laboratory, Technical Email:
jakob.skov@risoe.dk Due to
sample-specific technical
variability, transcript levels measured by qPCR need to be normalised
to
reference genes. However, many traditionally used reference genes have
proven
to be differentially regulated under some conditions, so efficient
methods to
select new stable reference genes are needed. Using
available datasets from the
Affymetrix Barley 1 GeneChip we identified 38 stably expressed barley
genes
from the ~20.000 genes present on the microarray. We selected nine top
ranking
genes together with five traditionally used reference genes for testing
in a
large qPCR experiment. This experiment included leaves from three
different
barley genotypes, ± treatment with the pathogenic barley powdery
mildew fungus
and sampling at four different time points after infection. The genes
were
subsequently ranked according to stability using the geNorm software.
Different
sets of optimal reference genes, consisting of both new and traditional
reference
genes, were identified for each genotype. Only one gene, encoding an
NADH
dehydrogenase, was among the top four most stable genes in all three
genotypes.
Other genes among the top four in one genotype were unstable in other
genotypes. A second qPCR experiment which included five biological
replica,
revealed three traditional and one novel reference gene to be
significantly
regulated (p<0.001) when comparing inoculated and un-inoculated
control
samples. Normalising to these genes would lead to erroneous
conclusions.
Finally three qPCR reference genes are recommended for experiment
dealing with
powdery mildew in the three genotypes respectively. By proof of
contradiction we
conclude that presently one cannot assume that universally applicable
reference
genes exist for different genotypes even within a species. We speculate
that
such genes may not exist at all, and recommend that reference genes are
(1)
always validated for the specific setup in which they are to be used
and (2)
selected from a set of potential reference genes generated by analysis
of
microarray data. The presented work describes a method to producing
such a list
and a setup for validation. P
088 Can
real-time NASBA compete with qPCR for GMO
detection? Dany Morisset, Kristina
Gruden National
Institute of Email:
dany.morisset@nib.si Introduction We developed
a non-PCR based method
for the multiplex quantitative detection of GMOs. This method called
NASBA
(Nucleic Acid Sequenced-Based Amplification) is a sensitive,
isothermal,
transcription-based amplification system for the specific replication
of
nucleic acid in-vitro. It is widely used for RNA target amplification
in virus
and bacteria detection. In this work, we show how this system can be
successfully adapted for mono- and multiplex DNA-based detection of
GMOs in a
real-time fashion. Materials and
methods Test samples
and DNA purification Genomic DNA
was purified from plant
material and reference flour samples containing defined percentages of
GMO
material. Concentrations of DNA were quantified by qPCR. Multiplex DNA
NASBA (conventional
and real-time) In a first
amplification step,
“tailed” primers were used in a single cycle Taq polymerase
amplification to
get the appropriate template for NASBA bordered by “universal” regions.
Universal primers corresponding to the universal borders in the
template DNA
were used for NASBA amplification based on the NucliSens® Basic Kit
(bioMérieux
bv, Boxtel, The Netherlands). In the case of real-time monitoring,
molecular
beacons (MWG-BIOTECH AG Ebersberg) corresponding to specific sequences
of the
target DNA were added to the reaction mix. Otherwise, amplification of
NASBA
products was quantified using classical qPCR with specific probe for
the target
DNA. Results The usual
protocol for NASBA as
proposed by the manufacturer failed in amplifying GMOs targets. The
optimisation of the procedure included the addition of a first
amplification
step to generate a suitable template prior to the NASBA reaction
itself.
Another improvement was the use of “tailed” primers during this first
step. In
the following NASBA reaction, the use of “universal” primers avoided
the
problem of complex primers mix and allowed the multiplexing of the
procedure.
Several target elements from various GMOs were amplified in simplex
NASBA
reactions showing strong amplification when compared to the control
DNA. The
improved real-time and conventional NASBA was shown to be sensitive and
specific. Multiplex
NASBA reactions were also
performed aiming specie-, construct-, and event-specific target
elements. Same
amplification rates were found for each target element compared to
simplex
NASBA reaction. These results demonstrate the specificity of the first
amplification step, and the non-discriminatory property of the
“universal”
primer set for any target element. Real-time and conventional NASBA
showed the
same results for multiplex amplifications. All results were compared to
qPCR
amplification parameters (efficiency, specificity, sensitivity…) Conclusion We show that
due to its sensitivity,
specificity, amplification efficiency and multiplexing, real-time NASBA
can be
used for DNA amplification in the goal of GMO detection. This method
shows
great potential to challenge with qPCR-based GMO detection. P
089 Identification
of heterozygous and homozygous sequence
changes in the MUTYH gene by High Resolution Melting Analysis. Rossella
Tricarico1, Benedetta Ciambotti1,
Roberta Sestini1, Maurizio Genuardi1 Claudio
Orlando2. 1Medical
Genetic Unit and and 2Clinical
Biochemistry Unit Department of Clinical Physiopathology, Email:
c.orlando@dfc.unifi.it High-resolution
melting analysis
(HRMA) is a mutation detection method based on the principle that the
melting
curves of DNA fragments vary depending on base composition.
Heterozygous
samples can be detected with high sensitivity, whereas homozygosity for
a
nucleotide change (A to T or C to G transition) may not lead to
significant
curve shape or melting temperature changes compared to homozygous
wild-type samples.
Therefore, HRMA has been mainly applied so far to the detection of
mutations
associated with autosomal dominant or X-linked disorders. In this
study, we
have evaluated whether HRMA could be used for the identification of
homozygous
mutations in the MUTYH gene, implicated in the autosomal recessive form
of
intestinal polyposis (MUTYH-associated polyposis; MAP). HRMA was first
tested
on a set of 30 samples of known genotype at exons 7 and 13, where the
mutations, 495a>g (Y165C) and 1145g>a (G382D) are located. These
account
for about 70% of pathogenic MUTYH äallelic
variants among Caucasians. HRMA was conducted on a Rotor Gene
6000 Instrument (Corbett Research, The Authors
wish to thank Diatech ( P
090 Internal
quality assessment scheme for real-time PCR
applications. Helene Polin 1,
Martin Danzer 1, Reinhard Haunschmid 2, Katja
Hofer 1,
Brigitte Fiedler 1, Johannes Pröll 1,
Christian Gabriel 1 1Red Cross
Transfusion Service of
Upper Austria, Email:
helene.polin@blutz.o.redcross.or.at Real-time PCR
is a key procedure of
molecular diagnostics in a clinical setting. The reliability of results
generated in routine diagnostics must be ensured by continuous internal
and
external quality controls. In contrast to existing quality assessment
schemes,
we developed an internal procedure exactly to control the validity of
generated
data based on the qualification of (1) real-time instruments and (2)
enzymes
and (3) statistical process control (SPC) of routine diagnostic assays. For the
qualification of supplies,
an in-house real-time PCR was introduced. MS Excel-based statistical
analysis
of the Cp data was generated with results automatically displayed in
Shewart
control charts. This quality assessment scheme was applied in our
molecular
diagnostic laboratory for 17 months to all real-time PCR supplies and
selected
real-time PCR assays. Whereas all 30 different lots of the LightCycler
FastStart DNA Master Hybridization Probes kit enzyme showed no
irregularities,
one outlier out of the133 data sets generated from 16 different
LightCycler
instruments was identified. Further maintenance revealed an
insufficient
fluorimeter device responsible for the inappropriate result. SPC applied
in the daily routine
testing for Hepatitis B virus (HBV) identified 1.5% of the
amplification runs
with control data beyond the action control limits (+3SD) displayed in
Shewart
control charts. Results generated within these runs were assigned as
invalid.
Therefore, this scheme for quality control of real-time PCR supplies
and assays
is easily applied and useful for every molecular diagnostic laboratory
and supports
in every-day quality management. P
091 miniProbe:
Highly Specific Homo-Labeled Probe
Technology for Real-Time qPCR. Xin X. and Mao F. AlleLogic
Biosciences Corporation, Email:
shanex@allelogic.com AllGlo probes
are novel fluorogenic
probes for nucleic acid detections in real time quantitative PCR.
Unlike
conventional dual labeled probes such as TaqMan probes, an AllGlo probe
has two
identical reporter dyes that are capable of quenching each other and
become
de-quenched once the probe is cleaved. AllGlo probes do not employ a
quencher
and have two signal-generating reporter dyes per oligo; they tend to
generate
much higher fluorescence signals. Furthermore, the simple composition
translates into low manufacturing cost. Recently, we
have developed the
second generation of AllGlo probes, called miniProbes. The miniProbes
are
significantly shorter than the older version of AllGlo probes. They
have a
calculated Tm of 55-60 deg. C contributed solely by the nucleic acid
sequence itself,
and the length can be as short as 15-16 nucleotides. Although the
calculated Tm
is lower than the annealing/extension temperature used in the universal
protocol, the miniProbe performs better than the regular AllGlo probe
that has
a calculated Tm of 65-70 deg. C when they are compared in TaqMan
assays.
miniProbes with shortened oligo length make quenching more efficient
and boast
low fluorescence baselines. The ∆Rn is at least equal or better than
TaqMan BHQ
probes or TaqMan MGB probes. We discovered that a miniProbe offers
higher
specificity than Taqman probe or TaqMan MGB probe in detecting single
point
mutations. Unlike TaqMan MGB probes, we have not found a single case
that a
miniProbe inhibits PCR reactions. P
092 Normalisation
of mRNA levels using expressed Alu
repeats (EARs) to investigate immunoregulation. Nina Witt1, Jo
Vandesompele2, Alimuddin Zumla1, Graham Rook1,
Jim Huggett1 1Centre for
Infectious Diseases &
International Health, University College London, UK and 2Centre
for
Medical Genetics, Ghent University Hospital, Belgium Email:
n.witt@ucl.ac.uk The
environmental Mycobacterium
vaccae has been shown to induce regulatory T cells which inhibit
the
allergic response in mice. We are studying the immunoregulatory effects
of M.
vaccae on human dendritic cells. To analyze cytokine expression
changes in
dendritic cells after treatment with M. vaccae , we first have
to
perform data normalisation. Normalisation of quantitative RT-PCR data
is of
critical importance to control for experimental variation. Using the
expression
of multiple internal reference genes is currently the most accurate
strategy to
control for experimental error and identify true changes in
transcription.
However, identification and measurement of multiple reference genes can
be
time-consuming and expensive. To tackle
this problem, we are
working on an alternative normalisation strategy: expressed Alu repeats
(EARs) that has the potential to provide accurate normalisation without
measuring multiple reference genes. Alu repeats are short
interspersed
nuclear elements (SINE) that comprise ~10% of the human genome and are
frequently expressed in the untranslated regions of mRNAs. Primers
designed to
amplify the Alu consensus sequence are used, allowing the
expression of
many different transcripts to be measured at the same time. As there
are so
many EARs, they provide a good measure of cDNA and could be used to
compensate
for experimental variation. This would potentially allow similar
accuracy to
using multiple reference genes with a much simpler strategy. The high
frequency of the Alu sequences
that provide an excellent normalisation strategy also cause a major
problem as
these assays are highly susceptible to contamination. Currently we are
optimising this strategy and are particularly interested in the source
of this
contamination. This work will decide whether we will utilise EARs as
our final
normalisation strategy when measuring cytokine responses in dendritic
cells. We
will also discuss whether certain defined levels of contamination can
ever be
acceptable. P
093 Quantitative
Analyses of TACC1 Alternative Splicing
Events in Gastric Cancer. Silina K., Abols A.,
Kalnina Z., Line A. Latvian
Biomedicine Research and
Study Email:
karina@biomed.lu.lv Introduction . In order to
look for novel cancer specific proteins
that could be used as diagnostic/prognostic markers or new therapeutic
targets
in gastric cancer we applied SEREX technique to gastric cancer cDNA
expression
library. As a result we identified 14 antigens including the mitotic
spindle
binding protein TACC1. Its serum reactive clone represented a
previously
unknown splice variant and the immune response to it was exclusively
cancer
patient specific. We analyzed it further to find out the possible
reasons of
its immunogenicity and its possibilities of application in therapy. Methods . We used
5`RLM-RACE approach to obtain full length
mRNA sequence of TACC1 which was absent in the serum reactive clone. To
analyze
expression patterns of TACC1 in various normal as well as gastric
cancer/adjacent normal tissue pairs we performed RT-PCR and qRT-PCR.
For qPCR
data normalization we used a normalization factor calculated from 3
most stable
genes in a given tissue panel. We amplified 7 housekeeping genes that
were published
to be used for qPCR in similar panels – YWHAZ, TBP, PolR2A, TUB3A,
GAPDH, ACTB,
PGK1 and determined the 3 most stable genes by GeNorm – PolR2A, ACTB,
TUB3A for
various normal tissues; ACTB, YWHAZ, TBP for tumour/adjacent normal
tissue
panel. Results . So far we
have identified 17 transcripts of TACC1
which differ in exon composition as well as promoter usage. Each of
these
transcripts can be spliced with or without a novel exon (Ex8) that was
present
in SEREX clone. The RT-PCR analyses showed that TACC1 isoforms without
Ex8 are
expressed in most normal tissues, while Ex8 is being included
predominantly in
gastric cancer and normal brain. Our qPCR results showed that there is
a
distinct expression pattern for each splice variant and that splicing
deregulation
rather than changed transcription intensity causes overexpression of
Ex8
containing isoforms in cancers comparing to adjacent normal tissues. To
find
the possible reasons of Ex8 inclusion in cancer we looked at mRNA
expression
levels of 4 splicing factors which are predicted to bind enhancer
elements of
Ex8. However we were unable to detect any differences between normal
and
cancerous tissues meaning that other splicing regulatory events are
disturbed
and result in Ex8 inclusion in gastric cancer transcripts. In several
isoforms
the inclusion of Ex8 disturbs a nuclear localization signal. Whether
that might
contribute to oncogenic events remains to be studied. Conclusions . We have
identified 17 different transcripts of
TACC1 and shown that in about 50% of gastric cancer cases the
alternative
splicing of TACC1 is deregulated through mechanisms other than splicing
enhancer transcription intensity. It is not known how it contributes to
the
immunogenicity of TACC1 nor how that implicates in cancerogenesis.
Isoforms
containing Ex8 can be used as gastric cancer biomarkers, but as they
are
present abundantly in the brain, their use as therapeutic targets is
unlikely. P
094 Real-time
RT-PCR protocol adaptation case in
instrument change. Karus A., Karus V. Estonian Email:
avo.karus@emu.ee For basis for
adaptation in
instrument was used the 2-step RT-PCR protocol for quantification of
elongation
factor EF-Tu optimised for Smartcycler. We used for transference Roche
recommendations
for optimisation as well as Roche LightCycler RNA master SYBR Green I
method
manual and we performed 1-step RT-PCR using same primers as for
Smartcycler.
Primers: Ef-Tu forward - GAGATGGAGAATACGTCTTCGA; Ef-Tu reverse -
ACCAGAGCGTGCGATTG. All standards and samples were processed in
duplicates for
both assays. SYBR Green I was used for detection format. All changes
were based
only on theoretical basic knowledge. RT was performed at 61 C in 20
min.
Annealing temperature was set according to calculated primer melting
temperature on 50 centigrade. To ensure higher efficiency the
denaturizing step
was 5 s, annealing 8 and extension step 15 seconds (in optimised
protocol for
Smartcycler accordingly 15, 20 and 15 s). Temperature ramp rate was set
to maximum
except from annealing to extension only 2 C/s. The changes done in
instrument
and RT-PCR method change allowed getting quantification with excellent
efficiency (1.96) and good uniformity. Results showed robustness of
LightCycler
system as well as reagents, that allowed obtain reliable quantitative
results
in low copy number (less than 100) of target on LightCycler 2.0
instrument with
high specificity of amplification, checked by melting curve analysis in
less
than 80 minutes (equal to RT-step duration in 2-step PCR protocol)
without any
optimisation steps. The single amplification product has Tm 80.1 C. P
095 Reference
gene stability in hepatocyte primary cell
cultures of Atlantic cod (Gadus morhua). Liv I. R.
Søfteland1 and
Pål A.
Olsvik1 1National Email:
lso@nifes.no In salmonids
hepatocyte primary cell
cultures are commonly used for toxicity testing in bioassays. So far no
one has
described a protocol on how to use Atlantic cod hepatocytes in
bioassays,
mainly due to the high fat content in these cells, causing the cells to
burst
during isolation. In this work we describe an experiment in which we
were able
to isolate intact liver cells from one adult mature female individual
(3.0 kg),
expose them to three concentrations of PCB 138 (0.1 µM, 1
µM and 10 µM plus one
unexposed control group, n=3) and extract high quality RNA (average RIN
value
9.6±0.2) for gene expression analysis. PCB 138 is one of the
most widespread
PCB congeners, and of major concern in the marine environment (AMAP,
1998).
This PCB congener has previously been used in in vitro exposure studies
(Gooch
et al., 1989; Schmitz et al., 1995). We were able to quantify the
transcription
levels of three reference genes and four target genes encoding proteins
known
to be affected by oxidative stress, namely glutathione peroxidase
(GSH-Px),
glutathione reductase (GR), glutathione S-transferase (GST) and Mn
superoxide
dismutase (Mn SOD), in addition to the detoxifying enzyme CYP1A and
vitellogenin (Vgt). The results showed that heat shock cognate 70 (the
non-inducible form of HSP70) was slightly more stable than elongation
factor 1A
and beta-actin, with M-values of 0.152, 0.165 and 0.171, respectively
(analyzed
by GeNorm) (Vandesompele et al., 2002). CYP1A is one of the genes known
to be
affected by PCB 138 (MacFarland & Clarke, 1989), but surprisingly,
we were
not able to quantify significant differences between the control and
the
exposed groups. Nor could we measure significant differences in
transcription
levels between the control and the exposed groups for Vtg, GSH-Px and
GR.
Further only minor, non-significant differences were found between the
control
group and the groups of cells exposed to PCB 138 for GST and Mn SOD. 1. AMAP
(1998). AMAP Assessment Report: Arctic
Pollution Issues. Arctic Monitoring and Assessment Programme (AMAP). 2. Gooch,
J.W., Elskus, A.A., Kloepper-Sams, P.J., 3. McFarland,
V.A. & Clarke, J.U. (1989).
Environmental Health Perspectives, 81, 225-239. 4. Schmitz,
H.-J., Hagenmaier, A., Hagenmaier, H.-P.,
Bock, K.W. & Schrenk, D. (1995). Toxicology, 99, 47-54. 5.
Vandesompele, J., Preter, K.D., Pattyn, F., Poppe,
B., P
096
Tony Remans, Karen
Smeets,
Jaco Vangronsveld, Ann Cuypers Environmental
Biology, Email:
tony.remans@uhasselt.be From a
general biological and a more
specific physiological perspective, essential micro-elements (e.g.
Copper, Cu)
and non-essential trace elements (e.g. Cadmium, Cd) can be
distinguished within
the group of metals. From certain exposure levels, non-essential trace
elements
are toxic for plants, and even though micro-elements are essential for
the
plant, they can become toxic for plants at higher concentrations. This
can
cause a disruption of physiological processes, such as photosynthesis,
transpiration,… which can lead to chlorosis, necrosis, reduced growth…
Also at
lower exposures to trace elements, when no obvious changes to the plant
can be
detected visually, a number of biological and molecular changes are
taking
place. Several studies have observed that the exposure of plants to
toxic
concentrations of these elements provokes oxidative stress. Oxidative
stress
occurs when the balance between oxidants (such as reactive oxygen
species,
ROS), and antioxidants (which include certain enzymes and metabolites),
is
shifted towards the oxidants. In our
studies of Arabidopsis
thaliana exposed to Cd or Cu, we quantify gene expression of
anti-oxidative
defence genes (superoxide dismutases, catalases, peroxidases) and genes
that
can cause oxidative stress (NADPH oxidases, lipoxygenases). Especially
when
studying Cu stress, we found that some widely used reference genes for
relative
quantification were not stably expressed between different treatments.
In order
to determine more suitable reference genes, we tested a series of genes
for
Arabidopsis as proposed by Czechowski et al, and used the geNorm
algorithm
(Vandesompele et al) to identify the most stably expressed reference
genes in
roots and leaves of Arabidopsis under Cu and Cd stress. P
097 Frank Gerlach1,2, Aaron Avivi3,
Thorsten Burmester2, Eviatar Nevo3, Thomas Hankeln1 1Institute of
Molecular Genetics,
University of Mainz, 55099 Mainz, Germany, 2Biocenter
Grindel,
Animal Physiology, University of Hamburg, 20146 Hamburg, Germany and 3Institute
of Evolution, University of Haifa, Haifa 31905, Israel Email:
frank.gerlach@uni-hamburg.de Neuroglobin,
primarily expressed in
neurons of the CNS and PNS, and cytoglobin, found in fibroblasts of all
organs
and in distinct neuronal cells, are recently discovered O2-binding
respiratory
proteins of vertebrates. Their physiological function is discussed
related to
O2 supply, ROS scavenging, NO detoxification and other mechanisms. Here we
report expression patterns
of these globins and of myoglobin in mole rats which are able to
survive
extended periods of severe hypoxia in their underground burrows without
damage.
Quantitative RT-PCR and Western blot analyses show that both globins
are
expressed at elevated levels in Spalax versus rat. This suggests that
both
globins contribute to a pre-adaptation of Spalax towards a lack of O2.
After
extended periods of hypoxia (10% O2 for 22/44hrs), both globins are
down-regulated at the mRNA level in both species. The largely parallel
pattern
of gene regulation of neuroglobin and myoglobin suggests similar
cellular
functions. Cytoglobin
shows an augmented
normoxic expression in Spalax vs. rat only in brain tissue, but not in
heart
and liver. Hypoxia specifically induces cytoglobin in heart and liver
of both
mammals, with the most pronounced response (12x up) in Spalax heart.
That
indicates that cytoglobin possibly fulfils different roles in
fibroblast-like
cells and in neurons. P
098 Spinsanti G.1, Panti C.1,
Casini S.2, Marsili L.2, Fossi M.C.2 1Department of
Evolutionary Biology, Email:
spinsanti@unisi.it Odontocete
cetaceans occupy the top
position of the marine food-web and are particularly sensitive to the
bioaccumulation of lipophilic contaminants with endocrine disrupting
capacity.
Skin biopsies of marine mammals can be easily obtained from
free-ranging
specimens using non-lethal techniques and previous ecotoxicological
studies
have assessed their suitability as fresh biological material for the
determination of toxicological hazard. Up to now, quantitative
Real-Time PCR
has never been used in skin biopsies to quantify the expression of
target genes
induced by exposure of animals to contaminants. A limitation for the
application of qRT-PCR is the need for appropriate reference genes
which allow
the correct quantification of gene expression levels. In this context,
a
systematic evaluation of potential reference genes in cetacean skin
biopsies is
presented, in order to validate future qRT-PCR studies aiming at using
the
expression of selected genes as non-lethal biomarkers. Ten commonly
used
house-keeping genes were partially sequenced in the striped dolphin ( Stenella
coeruleoalba ) and, for each gene, PCR primer pairs were
specifically
designed and tested in qRT-PCR assays. The expression of these
potential
control genes was examined in 30 striped dolphin skin biopsy samples,
obtained
from specimens inhabiting the north-western P
099 Berisha Bajram 1,
Kliem Heike 1, Welter Harald 1, Pfaffl W.
Michael 1,
Pfarrer Christiane 2, Schams Dieter1 1Physiologie
Weihenstephan, TUM, Email:
berisha@wzw.tum.de The PA system
members, tissue
plasminogen activator (tPA), urokinase PA (uPA) and their inhibitors
(PAI-1 and
PAI-2), are supposed to be important regulators of the tissue
remodeling in the
ovary. The aim of this study was to evaluate the mRNA patterns of tPA,
uPA its
receptor uPAR, PAI-1 and PAI-2 during different functional stages in
the bovine
ovary. In our first experiment ovaries containing preovulatory
follicles or new
CL were collected by transvaginal ovariectomy at 0, 4, 10, 20 and 25h
(follicles) and 60h (CL day 1-2) relative to injection of GnRH. Second
experiment; corpora lutea were divided in following groups: Days 1-2,
3-4, 5-7
and 8-12 of the estrous cycle. Third experiment; cows in the mid-luteal
phase
(days 8-12) were injected with Cloprostenol (Estrumate) for induction
of
luteolysis and CL were collected at 0, 0.5, 2, 4, 12, 24, 48 and 64h
after
injection. Real-time RT-PCR (Rotor Gene) was employed to determine mRNA
expressions. Experiment 1: tPA mRNA increased 4h after GnRH
(during LH
surge) and
remained high during the whole experimental period. uPA transcripts did
not
change in follicle classes during periovulation but increased
significantly
only after ovulation. Both uPAR and PAI-1 mRNA expression increased in
follicle
group at 4h after GnRH, in order to increase again after ovulation. Experiment
2: uPA mRNA increased on days 8-12 of estrous cycle. In contrast,
PAI-1 und
PAI-2 mRNA were high on days 1-7 and decreased significantly on days
8-12 while
uPAR and tPA mRNA did not change throughout the investigated periods. Experiment
3: After induced luteolysis the PA system members (tPA, uPA, uPAR)
and
their inhibitors were upregulated from 2h till 64h, only tPA increased
already
after 0.5h. The strong upregulation of tPA, PAI-1 and uPAR during LH
surge
suggest them to be important mediators of LH dependent rupture of
bovine
follicle. In addition these data suggest, that members of the PA system
play an
important role during CL formation and function as well as in
degradation of
extracellular matrix during induced luteolysis in cow. Supported by DFG
(BE
3189/2-1). P
100 The
Intricacies of Multiplexing Revealed through a
Pathogen Detection Assay. V. Evan
Messenger, Ben Sowers Biosearch
Technologies, Email:
evan@biosearchtech.com The
intensifying demand to detect
pathogens in food products, agriculture, and the environment can be met
with
speed and confidence by multiplexing PCR assays together.
Spectrally-distinct fluorophores
and quenchers provide the ability to detect multiple genetic signatures
that
distinguish closely related strains, all within the same reaction
chamber. Here
we present amplifications from a TaqMan assay engineered to detect the
virulence
factors of Bacillus anthracis and identify several common laboratory
strains, while
also distinguishing a closely-related organism. Competing
amplifications place
new demands on the performance of each assay, and we explore the added
effort
required to successfully multiplex sequence design, master mix
formulation, and
performance optimization. With pathogen detection as one possible
application, we
show that multiplexing is ideally suited toward assays that will be run
regularly, or where sample material may be precious. P
101 Ann-Elise
Olderbakk Jordal1, Pål.
A. Olsvik2,
Tom Ole Nilsen1, Jon Amberg3, Camilla Myr1, 1Dept of
Biology, University of
Bergen, N- 5007 Bergen, Norway, 2National Institute of
Nutrition and
Seafood Research (NIFES), Post box 2029 Nordnes, 5817 Bergen, Norway, 3Aquaculture
Research Institute, University of Idaho, Moscow, ID 83844, U.S Email:
ann-elise.jordal@bio.uib.no Housekeeping
genes may vary in their
expression with the experimental conditions. When studying ontogeny of
genes
that are influenced by both diet and hormonal stimuli, it is important
to
evaluate the use of housekeeping genes for normalisation. The growth
rate of
the developing larvae also challenges the use of housekeeping genes as
cells
divide at a high rate. Our studies aim to describe the ontogeny of the
digestive system in developing marine fish larvae. This information is
vital in
order to formulate proper feeds in aquaculture. Similar to most other
marine
fish larvae, Atlantic cod has a very simple digestive system at the
onset of
exogenous feeding and may therefore have a limited capacity to
completely
digest complex proteins into free amino acids (1). Absorption of
peptides via
the oligopeptide transporter (PepT1) might therefore be very important
to
utilise dietary proteins (1,2). However no knowledge exists on the
spatial and
temporal expression of PepT1 and how development and diet influence the
expression of PepT1. Digestion is a complex, but closely orchestrated
process,
involving enzyme and fluid secretions and motility, culminating in
absorption
and evacuation. CCK plays a key role in the stimulation of pancreatic
enzyme
secretion, gallbladder contraction, intestinal peristalsis, delaying of
gastric
emptying and control of food intake (3). CCK expression is therefore
believed
to increase in a temporal fashion (4). Our aim is to characterise the
ontogeny
of the digestive system and examine gene expression of PepT1 and CCK in
Atlantic cod, Gadus morhua L, by examining the temporal and
spatial
expression of PepT1 and CCK using in situ hybridisation and
q-PCR. Other
strategies for normalisation will be evaluated. The functional
implications for
the processing capacity of the larval digestive tract will be discussed. P
102 Validation
of the Plexor™ Primer Design System. Katharine
Hoffmann, Benjamin Krenke,
Cynthia Sprecher, and Douglas Storts Promega
Corporation, Email:
doug.storts@promega.com The Plexor™
Primer Design System was
used to design primers for twenty different human mRNA targets
suggested by a
collaborator. Each primer pair was designed to span an intron,
minimizing the
potential of generating an amplification product from genomic DNA. A
BLAST
search was performed against the NCBI database to verify the primers
were specific
for the mRNA target of interest. All primer pairs were designed for use
in
duplex reactions targeting a ‘housekeeping’ gene (GAPDH). Quantitative
RT-PCR
was performed with the Plexor™ Two-Step qRT-PCR System. We will present
data
demonstrating the results of the validation study. P
103 Validation
of two reference genes for mRNA level
studies of murine disease models in neurobiology. Meldgaard M. Medical
Biotechnological Center, Email:
mmeldgaard@health.sdu.dk When
quantifying relative mRNA level
changes using RT rt-PCR, for a given set of experimental conditions or
a given
disease model, identification of an unaffected and unchanged reference
gene is
necessary. The reference gene enables normalization of test gene data
to ensure
their reliablility. Among the factors that may compromise the
reliability of
experimental data obtained in RT rt-PCR and make normalization against
reference gene(s) necessary are degradation of the sample RNA, and the
presence
in the extracted RNA of reverse transcriptase (RT) inhibitors. We present
data from evaluation and
validation of the genes encoding hypoxanthine guanine phosphoribosyl
transferase 1 (HPRT1) and glyceraldehyde phosphate dehydrogenase
(GAPDH) as
individual reference genes in RT rt-PCR based mRNA level studies
involving four
murine neurological disease models. We found relatively small
variations of
HPRT1 and GAPDH mRNA levels, changes that may even be accounted for by
the
intrinsic variability of the combined RT rt-PCR processes. We conclude
both
genes are suitable as reference gene with these four models, provided
quantification of subtle changes is avoided. We generally consider only
changes
in relative mRNA levels exceeding 2 fold for reproducible and reliable
using
only one reference gene. We
furthermore found, that given
certain experimental conditions, normalization to total RNA alone, i.e.
without
normalization to a reference gene, provides for equally reliable
relative mRNA
level results. The required experimental conditions encompass RNA
extraction
without RNA degradation, absence of RT inhibiting impurities in the RNA
extracts, precise quantification of RNA concentrations, and precise
handling
and pipetting throughout the RT and rt-PCR preparations. Reference Meldgaard M,
Fenger C, Lambertsen KL, Pedersen MD,
Ladeby R, Finsen B (2006) Validation of two reference genes for mRNA
level
studies of murine disease models in neurobiology. J Neurosci Meth 156:
101-110. P
104 Use
of Synthetic Template Oligonucleotides for Absolute
Quantification of Transcripts in Canine Osteoarthritis. Melissa
Mariani, Philip Day Email:
philip.j.day@manchester.ac.uk Real-time
reverse transcriptase
quantitative polymerase chain reaction (real-time RT-qPCR) is used for
the
precise measurement of gene expression in biological processes. For
sample
comparison in the detection of altered gene expression through
amplification by
using real-time RT-qPCR, the need for normalisation is required.
Reference
genes, also known as housekeeping genes, are assumed to have consistent
expression across all samples under investigation, which enables them
to be
used to normalize the quantity of target genes. Currently, no universal
reference gene exists that can be used across all tissue types in a
single
organism. Therefore, it is of great importance to select the best fit
reference
genes for each sample. Absolute quantification uses a standard curve of
known
concentrations of the RT qPCR amplicon sequence under investigation to
determine
the total mRNA of each transcript. Through a series of calculations one
can
determine the number of mRNA copies present per unit quantity of total
RNA. The
target gene expression values are normalized to the average reference
gene
expression value giving the number of target gene copies per molecule
of
reference gene. Unlike absolute quantification, relative quantification
uses
cycle threshold (Ct) values and normalizes each sample target gene
expression
to the average Ct value of the applied reference genes for each sample.
In this
experiment, microarray data was used to identify reference genes
(CG14980-PB,
IMP and MRPS7) produced from total RNA isolation in canine stimulated
and
unstimulated ligamentocytes and monocytes. RT qPCR assays were then
designed
for these reference genes and the target gene (IL-6) and applied to the
cell
samples. Synthetic template oligonucleotides (TOs) were designed for
each of
the genes of interest. Absolute and relative quantification methods
were
carried out to compare gene expression. The results showed analogous
rank order
between using relative and absolute quantification methods. IL-6
expression
tended to be slightly higher using the relative quantification method
compared
to absolute quantification. However, standard error values were large
enough
that significant changes in expression were unlikely. In conclusion,
although
absolute quantification shows similar results in gene expression
analysis to
relative quantification, it has less error. By calculating the number
of copies
of molecules of gene transcripts, it produces a more robust value
compared to
analyzing the cycle threshold for relative quantification. Therefore,
the use
of synthetic TOs for normalizing gene expression via absolute
quantification
should be investigated further. Additional
posters: P-1 Detection of defective PCR samples with module Outlier of
Kineret
software. Bar T., Tichopad A. and Dahan E. Email: tzachi.bar@labonnet.com For proper quantification
with real-time PCR, compared samples should have similar kinetics. Outlier is a computational tool
implemented within Kineret
software
that analyses real-time PCR data and verifies
the fulfilment of this prerequisite by detecting PCR samples with
defective
kinetics. By disabling such samples from the analysis, Outlier improves the overall results. Methodology To identify defective PCR: 1.Characterize the
kinetics of each amplification curve by several parameters. 2.Define a reference set
consisting of well performing samples, usually the standard curve
samples. 3. Self-asses the
reference set for PCRs with outlying kinetics. 4.Test the kinetics of
each unknown PCR against the reference set. 5. Use replicates at a given
experimental level (e.g. PCR replicates, RT replicates) to detect PCRs
with
outlying CT. 6. Intersect the results
of kinetics outlier detection and CT outlier detection. P-2 Allergen determination in food by
multiplex qPCR. Veronika Dvorak, Franziska
Zimmerli, Alda
Breitenmoser, René
Köppel Email: rene.koeppel@klzh.ch Official Food
Control Authority of the P-3 Biomarker Discovery Using Arrays
Printed With the
BioOdyssey™ Calligrapher™ MiniArrayer. J. A. Wibbenmeyer,1 N. Navarro,2
P.
E. Schwartz,2 A. VanMeter,3 V. S. Calvert,3 J. D. Wulfkuhle,3 E. F.
Petricoin
III,3 L. A. Liotta,3 V. Espina,3 1 Gene Expression Division,
Bio-Rad
Laboratories, Email:
teresa_rubio@bio-rad.com The use of microarrays in
transcriptional profiling has provided scientists with a wealth of
information.
This same technology has the potential to accelerate biomarker
discovery in
cancer research through the examination of protein expression and
posttranslational modifications in cells, tissues, or serum in a
multiplexed
miniature environment. Reverse-phase protein arrays (RPPAs) are
prepared from
tissue or cell lysates from multiple samples that are arrayed on a
slide and
then probed with specific antibodies. These arrays are being used to
uncover
biomarkers in ovarian (Wulfkuhle et al. 2003) and breast (Cowherd et
al. 2004)
cancers, as well as in leukemia (Tibes et al. 2006). In this poster, we
demonstrate the preparation of RRPAs for biomarker discovery by the
BioOdyssey Calligrapher
miniarrayer. P-4 Novel Uses of Microarrays in
Detecting Gene Silencing. Elizabeth T. Jordan, Cathleen
Karlak, Teresa Rubio, Luis Ugozzoli, and Jamie Wibbenmeyer. Gene Expression Division, Bio-Rad
Laboratories, Email:
teresa_rubio@bio-rad.com DNA microarrays allow many
simultaneous parallel measurements and transcriptional profiling using
these
arrays has provided scientists with a wealth of information. The same
technology can be used to build protein arrays, which hold similar
promise. We
describe here an approach using protein arrays to screen cells for gene
knockdown by b-actin siRNA and to examine changes in levels of the
actin-binding proteins destrin and cofilin. Arrays were produced on the
benchtop
with a BioOdyssey™ Calligrapher™ miniarrayer. Antibodies against
b-actin and
phosphorylated cofilin (p-cofilin) were tested for specificity using
western
blots. In one experiment, arrays were processed to monitor the
concentration of
b-actin in cells, with a standard curve of purified human actin printed
on the
grids. In another experiment on the same slide, changes in
phosphorylation
levels of cofilin were detected with an antibody specific for
p-cofilin. We
demonstrate that printed protein arrays can be screened using
antibodies either
singly or in pairs. Finally, the microarray results were validated
using qPCR. P-5 β-Actin Gene Silencing via siRNA and
Its Effects on
Protein Profiles. Todd Yeck, Katrina Academia,
Teresa
Rubio, Ning Liu, Tim Wehr, Steve Freeby, Yuan Yan, Joseph Terefe, Keith
Hamby,
and Aran Paulus. Gene Expression Division, Bio-Rad
Laboratories, Email:
teresa_rubio@bio-rad.com RNA interference (RNAi) is a
powerful tool used to modulate gene expression and determine gene
function.
Delivery of small interfering RNA (siRNA) into cells can result in
degradation
of a targeted messenger RNA (mRNA) and reduction of its protein
product.
Resulting changes in mRNA levels can be effectively monitored by
RT-qPCR, while
two-dimensional gel electrophoresis (2-DGE) allows the monitoring of
changes in
the expression levels of proteins associated with the function of that
gene in a
cellular pathway. Actin filaments are major cytoskeletal structures
that play
important roles in many cell physiological behaviors, such as
migration,
proliferation, and differentiation. The proper function of actin is
dependent on
the highly dynamic assembly and disassembly of its filaments. Many
proteins
interact with actin to regulate the cytoplasm through crosslinking,
bundling,
capping, or severing of actin filaments (Weeds 1982). In this study, we
examine
changes in the protein profiles of HeLa cells after siRNA-mediated
knockdown of
β-actin. Any changes in protein expression resulting from β-actin
knockdown may
be directly or indirectly associated with actin filament function. P-6 Parameters of effective siRNA
transfection using siLentFect
Lipid reagent. Teresa Rubio, Joseph Terefe,
Melody
Yang, Michael Sturges, Steve Kulisch and Keith Hamby Gene Expression Division, Bio-Rad
Laboratories, Email:
teresa_rubio@bio-rad.com
Any
changes ??? => please contact the scientific
organizer Michael W. Pfaffl via qPCR2007@wzw.tum.de
|